Mutagenetix > Incidental Mutation

Incidental Mutation 'R2360:Tll1'

247114

Institutional Source

Beutler Lab

Gene Symbol

Tll1

Ensembl Gene

ENSMUSG00000053626

Gene Name

tolloid-like

Synonyms

Tll-1, b2b2476Clo

MMRRC Submission

040342-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2360 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64467965-64659305 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64504435 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 654 (Y654H)

Ref Sequence

ENSEMBL: ENSMUSP00000070560 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066166]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000066166
AA Change: Y654H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626
AA Change: Y654H

Domain	Start	End	E-Value	Type
ZnMc	153	295	4.12e-56	SMART
CUB	349	461	4.12e-44	SMART
CUB	462	574	3.81e-48	SMART
EGF_CA	574	615	2.28e-9	SMART
CUB	618	730	9.11e-46	SMART
EGF_CA	730	770	4.25e-9	SMART
CUB	774	886	2.01e-47	SMART
CUB	887	1003	7.19e-35	SMART

Meta Mutation Damage Score

0.2435

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

93% (37/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	T	7: 29,274,214 (GRCm39)		noncoding transcript	Het
Abca14	A	G	7: 119,850,431 (GRCm39)	E761G	probably benign	Het
Apc	C	T	18: 34,394,179 (GRCm39)	T35I	probably damaging	Het
Arhgef2	T	A	3: 88,541,723 (GRCm39)	I228N	probably damaging	Het
Atp6v1g2	A	G	17: 35,456,638 (GRCm39)	E74G	probably damaging	Het
Ccdc70	A	G	8: 22,463,447 (GRCm39)	E79G	probably damaging	Het
Cdc42ep4	A	G	11: 113,619,528 (GRCm39)	S288P	probably damaging	Het
Cip2a	C	T	16: 48,837,828 (GRCm39)	Q843*	probably null	Het
Cpn2	T	C	16: 30,078,321 (GRCm39)	D460G	probably benign	Het
Crtam	A	G	9: 40,884,811 (GRCm39)	*393Q	probably null	Het
Cwc22	A	G	2: 77,757,591 (GRCm39)	I179T	probably damaging	Het
Cyp3a41b	T	C	5: 145,507,221 (GRCm39)	M240V	probably benign	Het
Dnah8	A	T	17: 30,896,178 (GRCm39)	D864V	probably benign	Het
Map3k7	T	C	4: 31,964,302 (GRCm39)	S14P	unknown	Het
Med25	A	G	7: 44,534,566 (GRCm39)	S150P	probably damaging	Het
Mex3b	T	C	7: 82,517,070 (GRCm39)	V71A	probably benign	Het
Morc3	T	C	16: 93,638,275 (GRCm39)	L19S	probably damaging	Het
Morn1	T	A	4: 155,176,770 (GRCm39)	S98T	probably damaging	Het
Mthfd1l	G	T	10: 4,006,771 (GRCm39)	A678S	probably damaging	Het
Napa	A	G	7: 15,848,083 (GRCm39)	Y200C	probably damaging	Het
Nr5a2	T	C	1: 136,876,565 (GRCm39)	I33V	probably benign	Het
Or14j6	A	G	17: 38,215,345 (GRCm39)	K303E	possibly damaging	Het
Pcnx1	A	G	12: 81,996,960 (GRCm39)	D952G	probably damaging	Het
Phf20l1	G	A	15: 66,466,769 (GRCm39)	R66Q	probably damaging	Het
Resf1	A	G	6: 149,236,145 (GRCm39)	I1488M	probably benign	Het
Rfk	A	G	19: 17,375,960 (GRCm39)	T85A	probably benign	Het
Sbno2	T	C	10: 79,893,855 (GRCm39)	D1179G	possibly damaging	Het
Serpina3k	C	T	12: 104,307,166 (GRCm39)	Q133*	probably null	Het
Setd4	T	C	16: 93,383,122 (GRCm39)		probably benign	Het
Sh2d4b	C	T	14: 40,582,548 (GRCm39)		probably null	Het
Slc1a6	G	A	10: 78,648,718 (GRCm39)	V480I	possibly damaging	Het
Slc39a3	A	T	10: 80,867,104 (GRCm39)	V214E	possibly damaging	Het
Traf3ip1	T	A	1: 91,427,374 (GRCm39)	C115S	unknown	Het
Vmn1r209	T	A	13: 22,989,836 (GRCm39)	I285F	probably damaging	Het
Vmn2r87	G	T	10: 130,315,631 (GRCm39)	T145K	probably damaging	Het
Zan	T	C	5: 137,394,388 (GRCm39)	T4484A	unknown	Het
Zfp768	T	C	7: 126,943,810 (GRCm39)	E106G	probably benign	Het
Zfp984	A	G	4: 147,839,234 (GRCm39)	I539T	possibly damaging	Het

Other mutations in Tll1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tll1	APN	8	64,469,170 (GRCm39)	missense	probably benign
IGL00583:Tll1	APN	8	64,658,326 (GRCm39)	missense	probably benign
IGL00767:Tll1	APN	8	64,524,355 (GRCm39)	missense	probably damaging	1.00
IGL01061:Tll1	APN	8	64,491,488 (GRCm39)	critical splice donor site	probably null
IGL01077:Tll1	APN	8	64,523,266 (GRCm39)	missense	probably benign	0.27
IGL01536:Tll1	APN	8	64,527,323 (GRCm39)	missense	probably damaging	1.00
IGL02137:Tll1	APN	8	64,469,132 (GRCm39)	missense	possibly damaging	0.73
IGL02168:Tll1	APN	8	64,507,001 (GRCm39)	missense	possibly damaging	0.50
IGL02378:Tll1	APN	8	64,470,660 (GRCm39)	nonsense	probably null
IGL02469:Tll1	APN	8	64,523,314 (GRCm39)	missense	probably benign	0.41
IGL02504:Tll1	APN	8	64,523,271 (GRCm39)	missense	possibly damaging	0.55
IGL02650:Tll1	APN	8	64,500,031 (GRCm39)	splice site	probably benign
IGL02937:Tll1	APN	8	64,658,319 (GRCm39)	nonsense	probably null
IGL03006:Tll1	APN	8	64,527,251 (GRCm39)	splice site	probably benign
R0518:Tll1	UTSW	8	64,551,505 (GRCm39)	missense	probably damaging	1.00
R0521:Tll1	UTSW	8	64,551,505 (GRCm39)	missense	probably damaging	1.00
R0541:Tll1	UTSW	8	64,491,486 (GRCm39)	splice site	probably null
R0612:Tll1	UTSW	8	64,524,344 (GRCm39)	missense	possibly damaging	0.91
R0690:Tll1	UTSW	8	64,527,324 (GRCm39)	missense	probably damaging	0.99
R0738:Tll1	UTSW	8	64,554,984 (GRCm39)	missense	probably damaging	1.00
R1454:Tll1	UTSW	8	64,491,524 (GRCm39)	missense	probably benign
R1619:Tll1	UTSW	8	64,509,307 (GRCm39)	missense	probably benign	0.25
R1625:Tll1	UTSW	8	64,494,476 (GRCm39)	missense	probably damaging	1.00
R1654:Tll1	UTSW	8	64,570,937 (GRCm39)	critical splice donor site	probably null
R1663:Tll1	UTSW	8	64,470,720 (GRCm39)	missense	probably benign	0.08
R1681:Tll1	UTSW	8	64,538,585 (GRCm39)	missense	possibly damaging	0.93
R1713:Tll1	UTSW	8	64,554,907 (GRCm39)	missense	probably damaging	0.99
R1908:Tll1	UTSW	8	64,478,141 (GRCm39)	missense	probably damaging	0.98
R2118:Tll1	UTSW	8	64,538,591 (GRCm39)	missense	probably benign	0.21
R2121:Tll1	UTSW	8	64,538,591 (GRCm39)	missense	probably benign	0.21
R2124:Tll1	UTSW	8	64,538,591 (GRCm39)	missense	probably benign	0.21
R2396:Tll1	UTSW	8	64,523,324 (GRCm39)	nonsense	probably null
R3032:Tll1	UTSW	8	64,551,526 (GRCm39)	missense	probably damaging	0.96
R3115:Tll1	UTSW	8	64,506,900 (GRCm39)	missense	probably damaging	1.00
R3889:Tll1	UTSW	8	64,658,258 (GRCm39)	missense	possibly damaging	0.77
R4126:Tll1	UTSW	8	64,571,048 (GRCm39)	missense	possibly damaging	0.78
R4182:Tll1	UTSW	8	64,494,545 (GRCm39)	missense	probably damaging	1.00
R4572:Tll1	UTSW	8	64,509,343 (GRCm39)	missense	possibly damaging	0.81
R4677:Tll1	UTSW	8	64,504,411 (GRCm39)	missense	probably benign	0.31
R4811:Tll1	UTSW	8	64,538,507 (GRCm39)	missense	possibly damaging	0.72
R4904:Tll1	UTSW	8	64,523,233 (GRCm39)	missense	probably benign	0.00
R4992:Tll1	UTSW	8	64,546,978 (GRCm39)	missense	probably damaging	0.98
R5061:Tll1	UTSW	8	64,506,983 (GRCm39)	missense	probably damaging	0.99
R5078:Tll1	UTSW	8	64,546,921 (GRCm39)	missense	probably damaging	1.00
R5208:Tll1	UTSW	8	64,504,527 (GRCm39)	missense	probably damaging	0.99
R5283:Tll1	UTSW	8	64,555,000 (GRCm39)	missense	possibly damaging	0.68
R5399:Tll1	UTSW	8	64,538,522 (GRCm39)	missense	probably damaging	1.00
R5699:Tll1	UTSW	8	64,570,974 (GRCm39)	missense	probably damaging	0.98
R5986:Tll1	UTSW	8	64,527,297 (GRCm39)	missense	probably damaging	0.99
R6019:Tll1	UTSW	8	64,494,525 (GRCm39)	missense	possibly damaging	0.83
R6046:Tll1	UTSW	8	64,506,925 (GRCm39)	nonsense	probably null
R6083:Tll1	UTSW	8	64,491,620 (GRCm39)	splice site	probably null
R6125:Tll1	UTSW	8	64,504,521 (GRCm39)	missense	probably damaging	1.00
R6222:Tll1	UTSW	8	64,551,568 (GRCm39)	missense	probably benign	0.18
R6275:Tll1	UTSW	8	64,504,401 (GRCm39)	nonsense	probably null
R6508:Tll1	UTSW	8	64,551,494 (GRCm39)	missense	probably damaging	0.99
R6758:Tll1	UTSW	8	64,494,439 (GRCm39)	critical splice donor site	probably null
R6782:Tll1	UTSW	8	64,524,315 (GRCm39)	missense	probably benign	0.00
R6848:Tll1	UTSW	8	64,551,544 (GRCm39)	missense	probably damaging	0.99
R7057:Tll1	UTSW	8	64,554,915 (GRCm39)	missense	probably damaging	1.00
R7144:Tll1	UTSW	8	64,577,979 (GRCm39)	missense	possibly damaging	0.90
R7244:Tll1	UTSW	8	64,478,222 (GRCm39)	missense	probably benign	0.00
R7336:Tll1	UTSW	8	64,478,176 (GRCm39)	missense	probably damaging	0.98
R7373:Tll1	UTSW	8	64,504,391 (GRCm39)	missense	probably damaging	0.98
R7626:Tll1	UTSW	8	64,551,268 (GRCm39)	splice site	probably null
R7687:Tll1	UTSW	8	64,574,526 (GRCm39)	nonsense	probably null
R7699:Tll1	UTSW	8	64,546,988 (GRCm39)	missense	probably benign	0.00
R7700:Tll1	UTSW	8	64,546,988 (GRCm39)	missense	probably benign	0.00
R7765:Tll1	UTSW	8	64,504,483 (GRCm39)	missense	probably damaging	1.00
R7790:Tll1	UTSW	8	64,478,271 (GRCm39)	nonsense	probably null
R7954:Tll1	UTSW	8	64,571,568 (GRCm39)	missense	probably damaging	1.00
R8710:Tll1	UTSW	8	64,577,940 (GRCm39)	missense	possibly damaging	0.77
R8792:Tll1	UTSW	8	64,538,499 (GRCm39)	missense	probably damaging	1.00
R9134:Tll1	UTSW	8	64,469,201 (GRCm39)	missense	possibly damaging	0.91
R9444:Tll1	UTSW	8	64,469,123 (GRCm39)	missense	probably damaging	1.00
R9539:Tll1	UTSW	8	64,494,457 (GRCm39)	missense	probably damaging	1.00
X0020:Tll1	UTSW	8	64,470,662 (GRCm39)	missense	probably damaging	0.97
Z1176:Tll1	UTSW	8	64,500,197 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGACCAGAAAGTACTTGCAG -3'
(R):5'- CGCTGCTTCACATTAAATGCAG -3'

Sequencing Primer
(F):5'- CCAGAAAGTACTTGCAGAAAGGAGC -3'
(R):5'- CTTCACATTAAATGCAGAGATGGCG -3'

Posted On

2014-10-30