Incidental Mutation 'R2360:Slc1a6'
ID247117
Institutional Source Beutler Lab
Gene Symbol Slc1a6
Ensembl Gene ENSMUSG00000005357
Gene Namesolute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
SynonymsEAAT4
MMRRC Submission 040342-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2360 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78780496-78814765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78812884 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 480 (V480I)
Ref Sequence ENSEMBL: ENSMUSP00000005490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005490]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005490
AA Change: V480I

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000005490
Gene: ENSMUSG00000005357
AA Change: V480I

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:SDF 55 519 8.5e-129 PFAM
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 93% (37/40)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene survive well and display no obvious abnormalities of behavior or brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,334,647 I1488M probably benign Het
4930432E11Rik A T 7: 29,574,789 noncoding transcript Het
Abca14 A G 7: 120,251,208 E761G probably benign Het
Apc C T 18: 34,261,126 T35I probably damaging Het
Arhgef2 T A 3: 88,634,416 I228N probably damaging Het
Atp6v1g2 A G 17: 35,237,662 E74G probably damaging Het
C330027C09Rik C T 16: 49,017,465 Q843* probably null Het
Ccdc70 A G 8: 21,973,431 E79G probably damaging Het
Cdc42ep4 A G 11: 113,728,702 S288P probably damaging Het
Cpn2 T C 16: 30,259,503 D460G probably benign Het
Crtam A G 9: 40,973,515 *393Q probably null Het
Cwc22 A G 2: 77,927,247 I179T probably damaging Het
Cyp3a41b T C 5: 145,570,411 M240V probably benign Het
Dnah8 A T 17: 30,677,204 D864V probably benign Het
Map3k7 T C 4: 31,964,302 S14P unknown Het
Med25 A G 7: 44,885,142 S150P probably damaging Het
Mex3b T C 7: 82,867,862 V71A probably benign Het
Morc3 T C 16: 93,841,387 L19S probably damaging Het
Morn1 T A 4: 155,092,313 S98T probably damaging Het
Mthfd1l G T 10: 4,056,771 A678S probably damaging Het
Napa A G 7: 16,114,158 Y200C probably damaging Het
Nr5a2 T C 1: 136,948,827 I33V probably benign Het
Olfr127 A G 17: 37,904,454 K303E possibly damaging Het
Pcnx A G 12: 81,950,186 D952G probably damaging Het
Phf20l1 G A 15: 66,594,920 R66Q probably damaging Het
Rfk A G 19: 17,398,596 T85A probably benign Het
Sbno2 T C 10: 80,058,021 D1179G possibly damaging Het
Serpina3k C T 12: 104,340,907 Q133* probably null Het
Setd4 T C 16: 93,586,234 probably benign Het
Sh2d4b C T 14: 40,860,591 probably null Het
Slc39a3 A T 10: 81,031,270 V214E possibly damaging Het
Tll1 A G 8: 64,051,401 Y654H probably damaging Het
Traf3ip1 T A 1: 91,499,652 C115S unknown Het
Vmn1r209 T A 13: 22,805,666 I285F probably damaging Het
Vmn2r87 G T 10: 130,479,762 T145K probably damaging Het
Zan T C 5: 137,396,126 T4484A unknown Het
Zfp768 T C 7: 127,344,638 E106G probably benign Het
Zfp984 A G 4: 147,754,777 I539T possibly damaging Het
Other mutations in Slc1a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Slc1a6 APN 10 78801813 missense probably damaging 1.00
IGL00496:Slc1a6 APN 10 78793308 missense probably damaging 1.00
IGL01099:Slc1a6 APN 10 78788997 missense possibly damaging 0.67
IGL02299:Slc1a6 APN 10 78793303 missense probably damaging 1.00
IGL02677:Slc1a6 APN 10 78789064 missense probably damaging 1.00
IGL02705:Slc1a6 APN 10 78801954 missense probably damaging 1.00
IGL03024:Slc1a6 APN 10 78814608 missense probably benign
IGL03185:Slc1a6 APN 10 78801907 missense probably damaging 1.00
IGL03046:Slc1a6 UTSW 10 78800174 missense probably benign 0.19
R0183:Slc1a6 UTSW 10 78791233 missense probably damaging 1.00
R0373:Slc1a6 UTSW 10 78801922 nonsense probably null
R0730:Slc1a6 UTSW 10 78796008 missense probably benign 0.13
R0774:Slc1a6 UTSW 10 78812824 missense probably benign 0.03
R0838:Slc1a6 UTSW 10 78796222 missense probably damaging 1.00
R1449:Slc1a6 UTSW 10 78800117 missense probably damaging 0.99
R1822:Slc1a6 UTSW 10 78812931 nonsense probably null
R1853:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1854:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1855:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1866:Slc1a6 UTSW 10 78791349 missense probably damaging 0.99
R2073:Slc1a6 UTSW 10 78800130 missense possibly damaging 0.93
R2279:Slc1a6 UTSW 10 78789048 missense probably benign 0.12
R2939:Slc1a6 UTSW 10 78814614 makesense probably null
R3111:Slc1a6 UTSW 10 78789081 missense probably damaging 0.99
R3926:Slc1a6 UTSW 10 78812881 missense possibly damaging 0.91
R4116:Slc1a6 UTSW 10 78787889 missense probably benign 0.00
R4798:Slc1a6 UTSW 10 78800118 missense probably damaging 1.00
R4916:Slc1a6 UTSW 10 78796251 missense probably damaging 1.00
R5054:Slc1a6 UTSW 10 78814602 missense probably damaging 1.00
R5166:Slc1a6 UTSW 10 78796269 critical splice donor site probably null
R5304:Slc1a6 UTSW 10 78793307 missense probably damaging 1.00
R5367:Slc1a6 UTSW 10 78787803 missense probably damaging 1.00
R5554:Slc1a6 UTSW 10 78795982 missense probably benign 0.00
R5635:Slc1a6 UTSW 10 78789091 missense possibly damaging 0.67
R5773:Slc1a6 UTSW 10 78793277 splice site probably null
R6117:Slc1a6 UTSW 10 78788988 missense possibly damaging 0.72
R6167:Slc1a6 UTSW 10 78801837 missense probably benign 0.40
R6174:Slc1a6 UTSW 10 78801907 missense probably damaging 1.00
R6221:Slc1a6 UTSW 10 78800076 missense probably damaging 0.98
R6323:Slc1a6 UTSW 10 78812887 missense probably damaging 1.00
R6339:Slc1a6 UTSW 10 78800085 missense possibly damaging 0.94
R6670:Slc1a6 UTSW 10 78787812 missense probably benign 0.00
R7166:Slc1a6 UTSW 10 78812812 missense possibly damaging 0.96
R7292:Slc1a6 UTSW 10 78814604 missense possibly damaging 0.84
R7548:Slc1a6 UTSW 10 78814431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCAGCATCACACATTTTG -3'
(R):5'- GGCCATAACTAGAGAGCCATC -3'

Sequencing Primer
(F):5'- GCATCACACATTTTGCTTTCATGATG -3'
(R):5'- TAGAGAGCCATCCCAATGCCTC -3'
Posted On2014-10-30