Incidental Mutation 'R2360:Sbno2'
ID247118
Institutional Source Beutler Lab
Gene Symbol Sbno2
Ensembl Gene ENSMUSG00000035673
Gene Namestrawberry notch 2
SynonymsStno
MMRRC Submission 040342-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R2360 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80056992-80105571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80058021 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1179 (D1179G)
Ref Sequence ENSEMBL: ENSMUSP00000151590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042771] [ENSMUST00000097227] [ENSMUST00000105372] [ENSMUST00000183037] [ENSMUST00000217972] [ENSMUST00000218630] [ENSMUST00000219260]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042771
AA Change: D1179G

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041635
Gene: ENSMUSG00000035673
AA Change: D1179G

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
low complexity region 177 189 N/A INTRINSIC
Pfam:AAA_34 209 500 8.2e-135 PFAM
Pfam:ResIII 239 419 7.7e-8 PFAM
low complexity region 611 631 N/A INTRINSIC
Pfam:Helicase_C_4 726 1004 7.5e-120 PFAM
low complexity region 1263 1283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097227
SMART Domains Protein: ENSMUSP00000094863
Gene: ENSMUSG00000075706

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
Pfam:GSHPx 97 204 6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105372
SMART Domains Protein: ENSMUSP00000101011
Gene: ENSMUSG00000075706

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:GSHPx 41 148 1.3e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154095
Predicted Effect probably benign
Transcript: ENSMUST00000183037
SMART Domains Protein: ENSMUSP00000138186
Gene: ENSMUSG00000075706

DomainStartEndE-ValueType
Pfam:GSHPx 1 108 3.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217876
Predicted Effect probably benign
Transcript: ENSMUST00000217972
Predicted Effect possibly damaging
Transcript: ENSMUST00000218630
AA Change: D1178G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219260
AA Change: D1179G

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1509 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 93% (37/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired osteoclast fusion, impaired osteoblastogenesis, osteopetrosis, increased bone mass, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,334,647 I1488M probably benign Het
4930432E11Rik A T 7: 29,574,789 noncoding transcript Het
Abca14 A G 7: 120,251,208 E761G probably benign Het
Apc C T 18: 34,261,126 T35I probably damaging Het
Arhgef2 T A 3: 88,634,416 I228N probably damaging Het
Atp6v1g2 A G 17: 35,237,662 E74G probably damaging Het
C330027C09Rik C T 16: 49,017,465 Q843* probably null Het
Ccdc70 A G 8: 21,973,431 E79G probably damaging Het
Cdc42ep4 A G 11: 113,728,702 S288P probably damaging Het
Cpn2 T C 16: 30,259,503 D460G probably benign Het
Crtam A G 9: 40,973,515 *393Q probably null Het
Cwc22 A G 2: 77,927,247 I179T probably damaging Het
Cyp3a41b T C 5: 145,570,411 M240V probably benign Het
Dnah8 A T 17: 30,677,204 D864V probably benign Het
Map3k7 T C 4: 31,964,302 S14P unknown Het
Med25 A G 7: 44,885,142 S150P probably damaging Het
Mex3b T C 7: 82,867,862 V71A probably benign Het
Morc3 T C 16: 93,841,387 L19S probably damaging Het
Morn1 T A 4: 155,092,313 S98T probably damaging Het
Mthfd1l G T 10: 4,056,771 A678S probably damaging Het
Napa A G 7: 16,114,158 Y200C probably damaging Het
Nr5a2 T C 1: 136,948,827 I33V probably benign Het
Olfr127 A G 17: 37,904,454 K303E possibly damaging Het
Pcnx A G 12: 81,950,186 D952G probably damaging Het
Phf20l1 G A 15: 66,594,920 R66Q probably damaging Het
Rfk A G 19: 17,398,596 T85A probably benign Het
Serpina3k C T 12: 104,340,907 Q133* probably null Het
Setd4 T C 16: 93,586,234 probably benign Het
Sh2d4b C T 14: 40,860,591 probably null Het
Slc1a6 G A 10: 78,812,884 V480I possibly damaging Het
Slc39a3 A T 10: 81,031,270 V214E possibly damaging Het
Tll1 A G 8: 64,051,401 Y654H probably damaging Het
Traf3ip1 T A 1: 91,499,652 C115S unknown Het
Vmn1r209 T A 13: 22,805,666 I285F probably damaging Het
Vmn2r87 G T 10: 130,479,762 T145K probably damaging Het
Zan T C 5: 137,396,126 T4484A unknown Het
Zfp768 T C 7: 127,344,638 E106G probably benign Het
Zfp984 A G 4: 147,754,777 I539T possibly damaging Het
Other mutations in Sbno2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Sbno2 APN 10 80064506 splice site probably benign
IGL01773:Sbno2 APN 10 80057831 missense probably damaging 1.00
IGL01869:Sbno2 APN 10 80060392 critical splice donor site probably null
IGL01911:Sbno2 APN 10 80069624 nonsense probably null
IGL02071:Sbno2 APN 10 80060641 missense probably damaging 1.00
IGL02094:Sbno2 APN 10 80057645 missense probably benign
IGL02220:Sbno2 APN 10 80072368 missense probably benign 0.04
IGL02366:Sbno2 APN 10 80064202 missense probably damaging 1.00
IGL02608:Sbno2 APN 10 80067402 splice site probably null
IGL03007:Sbno2 APN 10 80058550 splice site probably benign
IGL03083:Sbno2 APN 10 80057534 missense probably damaging 0.98
IGL03393:Sbno2 APN 10 80066901 missense probably damaging 1.00
R0034:Sbno2 UTSW 10 80058340 splice site probably benign
R0126:Sbno2 UTSW 10 80068853 splice site probably null
R0652:Sbno2 UTSW 10 80067294 missense probably damaging 1.00
R0964:Sbno2 UTSW 10 80084259 missense possibly damaging 0.75
R1571:Sbno2 UTSW 10 80060392 critical splice donor site probably null
R1601:Sbno2 UTSW 10 80060492 missense probably damaging 0.98
R1634:Sbno2 UTSW 10 80060634 missense possibly damaging 0.73
R1733:Sbno2 UTSW 10 80058508 missense possibly damaging 0.92
R1762:Sbno2 UTSW 10 80066606 missense probably damaging 1.00
R1832:Sbno2 UTSW 10 80060605 nonsense probably null
R1859:Sbno2 UTSW 10 80058639 nonsense probably null
R2086:Sbno2 UTSW 10 80057856 missense possibly damaging 0.89
R2136:Sbno2 UTSW 10 80062693 missense probably damaging 1.00
R4426:Sbno2 UTSW 10 80072358 missense probably null 0.02
R4504:Sbno2 UTSW 10 80060492 missense possibly damaging 0.46
R4692:Sbno2 UTSW 10 80086327 missense possibly damaging 0.90
R5044:Sbno2 UTSW 10 80062188 missense probably benign 0.11
R5166:Sbno2 UTSW 10 80066928 nonsense probably null
R5576:Sbno2 UTSW 10 80067337 missense probably damaging 0.99
R5665:Sbno2 UTSW 10 80058453 missense probably benign 0.00
R5709:Sbno2 UTSW 10 80086337 start codon destroyed probably null 0.89
R5828:Sbno2 UTSW 10 80066590 missense possibly damaging 0.84
R6192:Sbno2 UTSW 10 80060016 missense probably damaging 0.99
R6971:Sbno2 UTSW 10 80060034 missense possibly damaging 0.95
R7012:Sbno2 UTSW 10 80069518 intron probably benign
R7082:Sbno2 UTSW 10 80060090 splice site probably null
R7133:Sbno2 UTSW 10 80086312 missense probably damaging 1.00
R7438:Sbno2 UTSW 10 80069575 missense unknown
R7481:Sbno2 UTSW 10 80057499 missense probably benign 0.11
R7746:Sbno2 UTSW 10 80058874 missense probably damaging 0.99
R7964:Sbno2 UTSW 10 80068351 missense probably damaging 1.00
R8055:Sbno2 UTSW 10 80069431 missense possibly damaging 0.81
R8221:Sbno2 UTSW 10 80070011 missense probably benign
R8329:Sbno2 UTSW 10 80064387 missense probably damaging 1.00
X0026:Sbno2 UTSW 10 80057459 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TCCATCAGCTGCAGTTCCTG -3'
(R):5'- TTACTGTGTCCCCAGGTCACTG -3'

Sequencing Primer
(F):5'- TGCAGTACGCGGTGAAC -3'
(R):5'- TTGGAGCACTGCAGTCACAC -3'
Posted On2014-10-30