Incidental Mutation 'R2360:Vmn1r209'
ID247125
Institutional Source Beutler Lab
Gene Symbol Vmn1r209
Ensembl Gene ENSMUSG00000071491
Gene Namevomeronasal 1 receptor 209
SynonymsGm11315
MMRRC Submission 040342-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R2360 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22800629-22809682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22805666 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 285 (I285F)
Ref Sequence ENSEMBL: ENSMUSP00000153997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095961] [ENSMUST00000227038] [ENSMUST00000227265]
Predicted Effect probably damaging
Transcript: ENSMUST00000095961
AA Change: I285F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093657
Gene: ENSMUSG00000071491
AA Change: I285F

DomainStartEndE-ValueType
Pfam:TAS2R 2 294 9.8e-9 PFAM
Pfam:V1R 34 297 3e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227038
AA Change: I285F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000227265
AA Change: I285F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 93% (37/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,334,647 I1488M probably benign Het
4930432E11Rik A T 7: 29,574,789 noncoding transcript Het
Abca14 A G 7: 120,251,208 E761G probably benign Het
Apc C T 18: 34,261,126 T35I probably damaging Het
Arhgef2 T A 3: 88,634,416 I228N probably damaging Het
Atp6v1g2 A G 17: 35,237,662 E74G probably damaging Het
C330027C09Rik C T 16: 49,017,465 Q843* probably null Het
Ccdc70 A G 8: 21,973,431 E79G probably damaging Het
Cdc42ep4 A G 11: 113,728,702 S288P probably damaging Het
Cpn2 T C 16: 30,259,503 D460G probably benign Het
Crtam A G 9: 40,973,515 *393Q probably null Het
Cwc22 A G 2: 77,927,247 I179T probably damaging Het
Cyp3a41b T C 5: 145,570,411 M240V probably benign Het
Dnah8 A T 17: 30,677,204 D864V probably benign Het
Map3k7 T C 4: 31,964,302 S14P unknown Het
Med25 A G 7: 44,885,142 S150P probably damaging Het
Mex3b T C 7: 82,867,862 V71A probably benign Het
Morc3 T C 16: 93,841,387 L19S probably damaging Het
Morn1 T A 4: 155,092,313 S98T probably damaging Het
Mthfd1l G T 10: 4,056,771 A678S probably damaging Het
Napa A G 7: 16,114,158 Y200C probably damaging Het
Nr5a2 T C 1: 136,948,827 I33V probably benign Het
Olfr127 A G 17: 37,904,454 K303E possibly damaging Het
Pcnx A G 12: 81,950,186 D952G probably damaging Het
Phf20l1 G A 15: 66,594,920 R66Q probably damaging Het
Rfk A G 19: 17,398,596 T85A probably benign Het
Sbno2 T C 10: 80,058,021 D1179G possibly damaging Het
Serpina3k C T 12: 104,340,907 Q133* probably null Het
Setd4 T C 16: 93,586,234 probably benign Het
Sh2d4b C T 14: 40,860,591 probably null Het
Slc1a6 G A 10: 78,812,884 V480I possibly damaging Het
Slc39a3 A T 10: 81,031,270 V214E possibly damaging Het
Tll1 A G 8: 64,051,401 Y654H probably damaging Het
Traf3ip1 T A 1: 91,499,652 C115S unknown Het
Vmn2r87 G T 10: 130,479,762 T145K probably damaging Het
Zan T C 5: 137,396,126 T4484A unknown Het
Zfp768 T C 7: 127,344,638 E106G probably benign Het
Zfp984 A G 4: 147,754,777 I539T possibly damaging Het
Other mutations in Vmn1r209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Vmn1r209 APN 13 22806280 missense probably damaging 1.00
IGL01788:Vmn1r209 APN 13 22805662 missense probably damaging 0.97
IGL02738:Vmn1r209 APN 13 22806120 nonsense probably null
IGL03177:Vmn1r209 APN 13 22805854 missense possibly damaging 0.46
IGL03199:Vmn1r209 APN 13 22806050 missense possibly damaging 0.89
R0437:Vmn1r209 UTSW 13 22806356 missense probably benign 0.01
R0497:Vmn1r209 UTSW 13 22805948 missense probably damaging 1.00
R0506:Vmn1r209 UTSW 13 22805944 missense probably damaging 0.98
R1496:Vmn1r209 UTSW 13 22805764 missense probably damaging 1.00
R1644:Vmn1r209 UTSW 13 22806482 missense possibly damaging 0.52
R1829:Vmn1r209 UTSW 13 22806239 missense possibly damaging 0.95
R3434:Vmn1r209 UTSW 13 22806097 missense probably benign 0.04
R3435:Vmn1r209 UTSW 13 22806097 missense probably benign 0.04
R4082:Vmn1r209 UTSW 13 22805615 missense probably null 0.15
R4451:Vmn1r209 UTSW 13 22806498 missense probably benign 0.02
R4616:Vmn1r209 UTSW 13 22805965 missense probably damaging 1.00
R4618:Vmn1r209 UTSW 13 22806449 missense possibly damaging 0.87
R4801:Vmn1r209 UTSW 13 22805656 missense probably damaging 1.00
R4802:Vmn1r209 UTSW 13 22805656 missense probably damaging 1.00
R6035:Vmn1r209 UTSW 13 22806032 missense probably benign 0.02
R6035:Vmn1r209 UTSW 13 22806032 missense probably benign 0.02
R6908:Vmn1r209 UTSW 13 22806230 missense possibly damaging 0.60
R7162:Vmn1r209 UTSW 13 22805958 missense probably damaging 1.00
R7772:Vmn1r209 UTSW 13 22806494 missense possibly damaging 0.77
R8328:Vmn1r209 UTSW 13 22806473 missense probably benign 0.00
R8335:Vmn1r209 UTSW 13 22805807 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAATGCTGTAAATCACCTGGAAG -3'
(R):5'- AGCATGTCCTCTACCTTCAGAAC -3'

Sequencing Primer
(F):5'- GCTGTAAATCACCTGGAAGACTGTC -3'
(R):5'- AGAACTCCCCCTGAGCTGAGAG -3'
Posted On2014-10-30