Mutagenetix > Incidental Mutations

Incidental Mutation 'R2360:Phf20l1'

247128

Institutional Source

Beutler Lab

Gene Symbol

Phf20l1

Ensembl Gene

ENSMUSG00000072501

Gene Name

PHD finger protein 20-like 1

Synonyms

CGI-72, E130113K22Rik

MMRRC Submission

040342-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.358) question?

Stock #

R2360 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66577560-66647976 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 66594920 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 66 (R66Q)

Ref Sequence

ENSEMBL: ENSMUSP00000155538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230882] [ENSMUST00000230948]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048188
AA Change: R66Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: R66Q

Domain	Start	End	E-Value	Type
TUDOR	11	71	7.67e0	SMART
Agenet	11	73	3.53e0	SMART
Agenet	85	141	4.54e-1	SMART
TUDOR	85	141	5.75e-8	SMART
Pfam:DUF3776	210	319	1.3e-31	PFAM
Pfam:PHD20L1_u1	318	413	4.7e-47	PFAM
low complexity region	443	453	N/A	INTRINSIC
low complexity region	530	543	N/A	INTRINSIC
low complexity region	547	585	N/A	INTRINSIC
low complexity region	598	608	N/A	INTRINSIC
low complexity region	642	658	N/A	INTRINSIC
PHD	683	727	8.45e-3	SMART
low complexity region	879	887	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000229160
AA Change: R66Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000229576
AA Change: R66Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229590

Predicted Effect

probably damaging
Transcript: ENSMUST00000230882
AA Change: R66Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230915

Predicted Effect

probably damaging
Transcript: ENSMUST00000230948
AA Change: R66Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Meta Mutation Damage Score

0.6382

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

93% (37/40)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	G	6: 149,334,647	I1488M	probably benign	Het
4930432E11Rik	A	T	7: 29,574,789		noncoding transcript	Het
Abca14	A	G	7: 120,251,208	E761G	probably benign	Het
Apc	C	T	18: 34,261,126	T35I	probably damaging	Het
Arhgef2	T	A	3: 88,634,416	I228N	probably damaging	Het
Atp6v1g2	A	G	17: 35,237,662	E74G	probably damaging	Het
C330027C09Rik	C	T	16: 49,017,465	Q843*	probably null	Het
Ccdc70	A	G	8: 21,973,431	E79G	probably damaging	Het
Cdc42ep4	A	G	11: 113,728,702	S288P	probably damaging	Het
Cpn2	T	C	16: 30,259,503	D460G	probably benign	Het
Crtam	A	G	9: 40,973,515	*393Q	probably null	Het
Cwc22	A	G	2: 77,927,247	I179T	probably damaging	Het
Cyp3a41b	T	C	5: 145,570,411	M240V	probably benign	Het
Dnah8	A	T	17: 30,677,204	D864V	probably benign	Het
Map3k7	T	C	4: 31,964,302	S14P	unknown	Het
Med25	A	G	7: 44,885,142	S150P	probably damaging	Het
Mex3b	T	C	7: 82,867,862	V71A	probably benign	Het
Morc3	T	C	16: 93,841,387	L19S	probably damaging	Het
Morn1	T	A	4: 155,092,313	S98T	probably damaging	Het
Mthfd1l	G	T	10: 4,056,771	A678S	probably damaging	Het
Napa	A	G	7: 16,114,158	Y200C	probably damaging	Het
Nr5a2	T	C	1: 136,948,827	I33V	probably benign	Het
Olfr127	A	G	17: 37,904,454	K303E	possibly damaging	Het
Pcnx	A	G	12: 81,950,186	D952G	probably damaging	Het
Rfk	A	G	19: 17,398,596	T85A	probably benign	Het
Sbno2	T	C	10: 80,058,021	D1179G	possibly damaging	Het
Serpina3k	C	T	12: 104,340,907	Q133*	probably null	Het
Setd4	T	C	16: 93,586,234		probably benign	Het
Sh2d4b	C	T	14: 40,860,591		probably null	Het
Slc1a6	G	A	10: 78,812,884	V480I	possibly damaging	Het
Slc39a3	A	T	10: 81,031,270	V214E	possibly damaging	Het
Tll1	A	G	8: 64,051,401	Y654H	probably damaging	Het
Traf3ip1	T	A	1: 91,499,652	C115S	unknown	Het
Vmn1r209	T	A	13: 22,805,666	I285F	probably damaging	Het
Vmn2r87	G	T	10: 130,479,762	T145K	probably damaging	Het
Zan	T	C	5: 137,396,126	T4484A	unknown	Het
Zfp768	T	C	7: 127,344,638	E106G	probably benign	Het
Zfp984	A	G	4: 147,754,777	I539T	possibly damaging	Het

Other mutations in Phf20l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Phf20l1	APN	15	66629035	missense	probably benign	0.28
IGL00484:Phf20l1	APN	15	66615633	splice site	probably benign
IGL00668:Phf20l1	APN	15	66632849	missense	probably damaging	0.99
IGL00849:Phf20l1	APN	15	66636832	missense	probably benign	0.00
IGL00954:Phf20l1	APN	15	66641908	missense	probably damaging	1.00
IGL01025:Phf20l1	APN	15	66613132	missense	probably damaging	1.00
IGL01504:Phf20l1	APN	15	66597691	missense	possibly damaging	0.73
IGL02087:Phf20l1	APN	15	66628991	missense	probably damaging	1.00
IGL02273:Phf20l1	APN	15	66640025	missense	probably damaging	1.00
IGL02276:Phf20l1	APN	15	66615410	critical splice donor site	probably null
IGL02372:Phf20l1	APN	15	66641801	missense	probably damaging	1.00
IGL02589:Phf20l1	APN	15	66615632	splice site	probably benign
IGL02656:Phf20l1	APN	15	66629827	missense	probably damaging	1.00
IGL02691:Phf20l1	APN	15	66604864	missense	probably damaging	1.00
IGL02881:Phf20l1	APN	15	66594980	critical splice donor site	probably null
IGL02940:Phf20l1	APN	15	66595151	missense	probably damaging	1.00
IGL02943:Phf20l1	APN	15	66594884	missense	probably damaging	1.00
IGL03030:Phf20l1	APN	15	66641947	utr 3 prime	probably benign
IGL03034:Phf20l1	APN	15	66597403	missense	probably damaging	1.00
Abbreviated	UTSW	15	66632903	critical splice donor site	probably null
curt	UTSW	15	66639948	missense	possibly damaging	0.90
shorthand	UTSW	15	66609547	missense	probably damaging	1.00
PIT4305001:Phf20l1	UTSW	15	66613052	missense	possibly damaging	0.94
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0562:Phf20l1	UTSW	15	66609604	missense	probably damaging	1.00
R0605:Phf20l1	UTSW	15	66595122	missense	probably damaging	1.00
R0787:Phf20l1	UTSW	15	66615630	splice site	probably benign
R1458:Phf20l1	UTSW	15	66604813	missense	probably damaging	1.00
R1619:Phf20l1	UTSW	15	66615259	missense	possibly damaging	0.88
R1781:Phf20l1	UTSW	15	66632825	missense	probably damaging	1.00
R3973:Phf20l1	UTSW	15	66641816	missense	probably damaging	1.00
R4374:Phf20l1	UTSW	15	66604837	missense	possibly damaging	0.72
R4375:Phf20l1	UTSW	15	66615222	missense	probably benign	0.00
R4554:Phf20l1	UTSW	15	66597367	missense	probably damaging	1.00
R4913:Phf20l1	UTSW	15	66604855	missense	probably benign	0.03
R5092:Phf20l1	UTSW	15	66636913	missense	possibly damaging	0.46
R5491:Phf20l1	UTSW	15	66615785	missense	possibly damaging	0.67
R5713:Phf20l1	UTSW	15	66636820	missense	possibly damaging	0.85
R6126:Phf20l1	UTSW	15	66636824	missense	probably benign	0.02
R6213:Phf20l1	UTSW	15	66632903	critical splice donor site	probably null
R6569:Phf20l1	UTSW	15	66629824	missense	probably damaging	1.00
R6572:Phf20l1	UTSW	15	66609547	missense	probably damaging	1.00
R6808:Phf20l1	UTSW	15	66630913	missense	probably damaging	0.99
R7100:Phf20l1	UTSW	15	66604840	missense	probably benign	0.01
R7208:Phf20l1	UTSW	15	66604789	missense	probably benign	0.05
R7436:Phf20l1	UTSW	15	66597750	missense	possibly damaging	0.92
R7466:Phf20l1	UTSW	15	66636884	missense	probably damaging	1.00
R7604:Phf20l1	UTSW	15	66604084	missense	probably benign	0.02
R7863:Phf20l1	UTSW	15	66615235	missense	possibly damaging	0.94
R7991:Phf20l1	UTSW	15	66630919	missense	possibly damaging	0.64
R8015:Phf20l1	UTSW	15	66639948	missense	possibly damaging	0.90
R8161:Phf20l1	UTSW	15	66604073	missense	probably damaging	1.00
R8228:Phf20l1	UTSW	15	66639940	missense	possibly damaging	0.81
X0065:Phf20l1	UTSW	15	66597678	missense	probably damaging	0.99
X0065:Phf20l1	UTSW	15	66629806	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGGATATCTTTACCATTTGACACATGC -3'
(R):5'- GAGCCAGTACTTCTTCTCCAG -3'

Sequencing Primer
(F):5'- GCAGTGCATTAGTTTCTTAAACAG -3'
(R):5'- AGTACTTCTTCTCCAGCTTTAAAATC -3'

Posted On

2014-10-30