Mutagenetix > Incidental Mutations

Incidental Mutation 'R2360:Phf20l1'

247128

Institutional Source

Beutler Lab

Gene Symbol

Phf20l1

Ensembl Gene

ENSMUSG00000072501

Gene Name

PHD finger protein 20-like 1

Synonyms

CGI-72, E130113K22Rik

MMRRC Submission

040342-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.331) question?

Stock #

R2360 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66577560-66647976 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 66594920 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 66 (R66Q)

Ref Sequence

ENSEMBL: ENSMUSP00000155538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230882] [ENSMUST00000230948]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048188
AA Change: R66Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: R66Q

Domain	Start	End	E-Value	Type
TUDOR	11	71	7.67e0	SMART
Agenet	11	73	3.53e0	SMART
Agenet	85	141	4.54e-1	SMART
TUDOR	85	141	5.75e-8	SMART
Pfam:DUF3776	210	319	1.3e-31	PFAM
Pfam:PHD20L1_u1	318	413	4.7e-47	PFAM
low complexity region	443	453	N/A	INTRINSIC
low complexity region	530	543	N/A	INTRINSIC
low complexity region	547	585	N/A	INTRINSIC
low complexity region	598	608	N/A	INTRINSIC
low complexity region	642	658	N/A	INTRINSIC
PHD	683	727	8.45e-3	SMART
low complexity region	879	887	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000229160
AA Change: R66Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000229576
AA Change: R66Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229590

Predicted Effect

probably damaging
Transcript: ENSMUST00000230882
AA Change: R66Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230915

Predicted Effect

probably damaging
Transcript: ENSMUST00000230948
AA Change: R66Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Meta Mutation Damage Score

0.6382

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

93% (37/40)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	G	6: 149,334,647	I1488M	probably benign	Het
4930432E11Rik	A	T	7: 29,574,789		noncoding transcript	Het
Abca14	A	G	7: 120,251,208	E761G	probably benign	Het
Apc	C	T	18: 34,261,126	T35I	probably damaging	Het
Arhgef2	T	A	3: 88,634,416	I228N	probably damaging	Het
Atp6v1g2	A	G	17: 35,237,662	E74G	probably damaging	Het
C330027C09Rik	C	T	16: 49,017,465	Q843*	probably null	Het
Ccdc70	A	G	8: 21,973,431	E79G	probably damaging	Het
Cdc42ep4	A	G	11: 113,728,702	S288P	probably damaging	Het
Cpn2	T	C	16: 30,259,503	D460G	probably benign	Het
Crtam	A	G	9: 40,973,515	*393Q	probably null	Het
Cwc22	A	G	2: 77,927,247	I179T	probably damaging	Het
Cyp3a41b	T	C	5: 145,570,411	M240V	probably benign	Het
Dnah8	A	T	17: 30,677,204	D864V	probably benign	Het
Map3k7	T	C	4: 31,964,302	S14P	unknown	Het
Med25	A	G	7: 44,885,142	S150P	probably damaging	Het
Mex3b	T	C	7: 82,867,862	V71A	probably benign	Het
Morc3	T	C	16: 93,841,387	L19S	probably damaging	Het
Morn1	T	A	4: 155,092,313	S98T	probably damaging	Het
Mthfd1l	G	T	10: 4,056,771	A678S	probably damaging	Het
Napa	A	G	7: 16,114,158	Y200C	probably damaging	Het
Nr5a2	T	C	1: 136,948,827	I33V	probably benign	Het
Olfr127	A	G	17: 37,904,454	K303E	possibly damaging	Het
Pcnx	A	G	12: 81,950,186	D952G	probably damaging	Het
Rfk	A	G	19: 17,398,596	T85A	probably benign	Het
Sbno2	T	C	10: 80,058,021	D1179G	possibly damaging	Het
Serpina3k	C	T	12: 104,340,907	Q133*	probably null	Het
Setd4	T	C	16: 93,586,234		probably benign	Het
Sh2d4b	C	T	14: 40,860,591		probably null	Het
Slc1a6	G	A	10: 78,812,884	V480I	possibly damaging	Het
Slc39a3	A	T	10: 81,031,270	V214E	possibly damaging	Het
Tll1	A	G	8: 64,051,401	Y654H	probably damaging	Het
Traf3ip1	T	A	1: 91,499,652	C115S	unknown	Het
Vmn1r209	T	A	13: 22,805,666	I285F	probably damaging	Het
Vmn2r87	G	T	10: 130,479,762	T145K	probably damaging	Het
Zan	T	C	5: 137,396,126	T4484A	unknown	Het
Zfp768	T	C	7: 127,344,638	E106G	probably benign	Het
Zfp984	A	G	4: 147,754,777	I539T	possibly damaging	Het

Other mutations in Phf20l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Phf20l1	APN	15	66629035	missense	probably benign	0.28
IGL00484:Phf20l1	APN	15	66615633	splice site	probably benign
IGL00668:Phf20l1	APN	15	66632849	missense	probably damaging	0.99
IGL00849:Phf20l1	APN	15	66636832	missense	probably benign	0.00
IGL00954:Phf20l1	APN	15	66641908	missense	probably damaging	1.00
IGL01025:Phf20l1	APN	15	66613132	missense	probably damaging	1.00
IGL01504:Phf20l1	APN	15	66597691	missense	possibly damaging	0.73
IGL02087:Phf20l1	APN	15	66628991	missense	probably damaging	1.00
IGL02273:Phf20l1	APN	15	66640025	missense	probably damaging	1.00
IGL02276:Phf20l1	APN	15	66615410	critical splice donor site	probably null
IGL02372:Phf20l1	APN	15	66641801	missense	probably damaging	1.00
IGL02589:Phf20l1	APN	15	66615632	splice site	probably benign
IGL02656:Phf20l1	APN	15	66629827	missense	probably damaging	1.00
IGL02691:Phf20l1	APN	15	66604864	missense	probably damaging	1.00
IGL02881:Phf20l1	APN	15	66594980	critical splice donor site	probably null
IGL02940:Phf20l1	APN	15	66595151	missense	probably damaging	1.00
IGL02943:Phf20l1	APN	15	66594884	missense	probably damaging	1.00
IGL03030:Phf20l1	APN	15	66641947	utr 3 prime	probably benign
IGL03034:Phf20l1	APN	15	66597403	missense	probably damaging	1.00
PIT4305001:Phf20l1	UTSW	15	66613052	missense	possibly damaging	0.94
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0562:Phf20l1	UTSW	15	66609604	missense	probably damaging	1.00
R0605:Phf20l1	UTSW	15	66595122	missense	probably damaging	1.00
R0787:Phf20l1	UTSW	15	66615630	splice site	probably benign
R1458:Phf20l1	UTSW	15	66604813	missense	probably damaging	1.00
R1619:Phf20l1	UTSW	15	66615259	missense	possibly damaging	0.88
R1781:Phf20l1	UTSW	15	66632825	missense	probably damaging	1.00
R3973:Phf20l1	UTSW	15	66641816	missense	probably damaging	1.00
R4374:Phf20l1	UTSW	15	66604837	missense	possibly damaging	0.72
R4375:Phf20l1	UTSW	15	66615222	missense	probably benign	0.00
R4554:Phf20l1	UTSW	15	66597367	missense	probably damaging	1.00
R4913:Phf20l1	UTSW	15	66604855	missense	probably benign	0.03
R5092:Phf20l1	UTSW	15	66636913	missense	possibly damaging	0.46
R5491:Phf20l1	UTSW	15	66615785	missense	possibly damaging	0.67
R5713:Phf20l1	UTSW	15	66636820	missense	possibly damaging	0.85
R6126:Phf20l1	UTSW	15	66636824	missense	probably benign	0.02
R6213:Phf20l1	UTSW	15	66632903	critical splice donor site	probably null
R6569:Phf20l1	UTSW	15	66629824	missense	probably damaging	1.00
R6572:Phf20l1	UTSW	15	66609547	missense	probably damaging	1.00
R6808:Phf20l1	UTSW	15	66630913	missense	probably damaging	0.99
R7100:Phf20l1	UTSW	15	66604840	missense	probably benign	0.01
R7208:Phf20l1	UTSW	15	66604789	missense	probably benign	0.05
R7436:Phf20l1	UTSW	15	66597750	missense	possibly damaging	0.92
R7466:Phf20l1	UTSW	15	66636884	missense	probably damaging	1.00
R7604:Phf20l1	UTSW	15	66604084	missense	probably benign	0.02
R7863:Phf20l1	UTSW	15	66615235	missense	possibly damaging	0.94
R7946:Phf20l1	UTSW	15	66615235	missense	possibly damaging	0.94
R8015:Phf20l1	UTSW	15	66639948	missense	possibly damaging	0.90
X0065:Phf20l1	UTSW	15	66597678	missense	probably damaging	0.99
X0065:Phf20l1	UTSW	15	66629806	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGGATATCTTTACCATTTGACACATGC -3'
(R):5'- GAGCCAGTACTTCTTCTCCAG -3'

Sequencing Primer
(F):5'- GCAGTGCATTAGTTTCTTAAACAG -3'
(R):5'- AGTACTTCTTCTCCAGCTTTAAAATC -3'

Posted On

2014-10-30