Incidental Mutation 'R0288:Hdac4'
ID24713
Institutional Source Beutler Lab
Gene Symbol Hdac4
Ensembl Gene ENSMUSG00000026313
Gene Namehistone deacetylase 4
Synonyms4932408F19Rik
MMRRC Submission 038507-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0288 (G1)
Quality Score181
Status Validated
Chromosome1
Chromosomal Location91928779-92195699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91971006 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 675 (H675Q)
Ref Sequence ENSEMBL: ENSMUSP00000095249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008995] [ENSMUST00000097644] [ENSMUST00000187308]
Predicted Effect probably damaging
Transcript: ENSMUST00000008995
AA Change: H675Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000008995
Gene: ENSMUSG00000026313
AA Change: H675Q

DomainStartEndE-ValueType
Pfam:HDAC4_Gln 61 151 5e-38 PFAM
low complexity region 289 310 N/A INTRINSIC
low complexity region 354 368 N/A INTRINSIC
low complexity region 472 502 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
Pfam:Hist_deacetyl 661 985 1.4e-85 PFAM
low complexity region 1066 1075 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097644
AA Change: H675Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000187308
AA Change: H107Q

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140092
Gene: ENSMUSG00000026313
AA Change: H107Q

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 93 313 2.3e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194827
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.7%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class II of the histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. This protein does not bind DNA directly, but through transcription factors MEF2C and MEF2D. It seems to interact in a multiprotein complex with RbAp48 and HDAC3. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased thermal nociception threshold and seizures. Mice homozygous for a knock-out allele exhibit postnatal lethality, exencephaly, and abnormal skeleton morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,039,940 E413G possibly damaging Het
Amigo2 G T 15: 97,245,679 N287K probably damaging Het
Ankle2 T A 5: 110,236,390 I260K probably damaging Het
Apob C T 12: 7,990,779 R635* probably null Het
Camkv A G 9: 107,946,356 Y153C probably damaging Het
Capn9 A G 8: 124,600,491 probably benign Het
Ces2c A G 8: 104,849,744 I130V probably benign Het
Cfap44 T A 16: 44,415,894 probably benign Het
Cfhr3 A G 1: 139,597,687 noncoding transcript Het
Chmp1a G T 8: 123,208,006 D70E probably damaging Het
Coil G A 11: 88,981,868 G352R probably damaging Het
Colq T C 14: 31,543,992 E188G possibly damaging Het
Cyfip2 A G 11: 46,253,972 F685S possibly damaging Het
Cyp4f39 A G 17: 32,492,436 N519S probably benign Het
Dennd1c A T 17: 57,076,870 probably null Het
Dnah9 A T 11: 66,025,134 probably null Het
Dnmbp T C 19: 43,902,459 T290A possibly damaging Het
Dsc2 T C 18: 20,033,120 D818G probably damaging Het
Gnptab G A 10: 88,433,105 V557I probably benign Het
Kcnk3 T C 5: 30,588,420 M35T probably benign Het
Kif1b A T 4: 149,199,338 I1290N probably damaging Het
Klhl14 G A 18: 21,565,563 R398W probably damaging Het
Marveld1 T C 19: 42,147,826 F60L probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Ndst3 A T 3: 123,672,194 V43D probably benign Het
Nhsl1 A G 10: 18,524,046 D306G probably damaging Het
Nlrp2 A G 7: 5,328,545 V284A probably benign Het
Pcdhb15 T C 18: 37,475,398 V561A probably damaging Het
Pdcl2 T C 5: 76,312,497 I177V possibly damaging Het
Pkd1l3 G A 8: 109,646,499 probably null Het
Pla2g6 A C 15: 79,286,906 probably benign Het
Plekhj1 A T 10: 80,796,610 I122N probably damaging Het
Pmel T C 10: 128,714,306 I70T probably benign Het
Psip1 T C 4: 83,464,959 D273G probably damaging Het
Rictor A G 15: 6,786,540 I1098V probably benign Het
Rif1 T C 2: 52,110,013 S1160P probably damaging Het
Rsbn1l T C 5: 20,920,040 I255V probably damaging Het
Slc15a5 A G 6: 138,017,916 probably benign Het
Slc29a1 G A 17: 45,589,804 R111W probably damaging Het
Slc36a1 G A 11: 55,219,087 A74T probably damaging Het
Slc5a7 A T 17: 54,293,018 Y122* probably null Het
Slc6a3 G T 13: 73,560,928 G324W probably damaging Het
Sltm T C 9: 70,579,351 S433P probably damaging Het
Spta1 T C 1: 174,243,179 S2190P probably damaging Het
Sry A T Y: 2,662,818 F281I unknown Het
Stk32a T A 18: 43,304,995 probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbl3 G A 17: 24,701,807 H612Y probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Top2a A G 11: 99,016,423 probably benign Het
Usp9y A T Y: 1,333,606 probably benign Het
Vldlr G A 19: 27,240,651 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r28 A G 7: 5,488,021 L409P probably damaging Het
Vps13c T C 9: 67,927,366 V1659A probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp280d A T 9: 72,331,339 K646* probably null Het
Zfp36 A G 7: 28,378,241 S81P probably benign Het
Zfp618 A T 4: 63,132,934 T651S possibly damaging Het
Other mutations in Hdac4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Hdac4 APN 1 91959415 missense probably damaging 0.99
IGL01396:Hdac4 APN 1 91959474 splice site probably benign
IGL01536:Hdac4 APN 1 91930146 utr 3 prime probably benign
IGL01860:Hdac4 APN 1 91933695 missense probably benign 0.31
IGL02110:Hdac4 APN 1 91984405 missense probably benign 0.00
IGL02201:Hdac4 APN 1 91987660 splice site probably null
IGL02294:Hdac4 APN 1 91982207 missense probably benign
IGL02367:Hdac4 APN 1 91958449 splice site probably benign
IGL02429:Hdac4 APN 1 92012695 missense probably benign 0.00
IGL02966:Hdac4 APN 1 92054945 missense possibly damaging 0.94
IGL03250:Hdac4 APN 1 91934600 critical splice donor site probably null
R0067:Hdac4 UTSW 1 92029984 missense probably damaging 1.00
R0103:Hdac4 UTSW 1 91975644 missense possibly damaging 0.73
R0334:Hdac4 UTSW 1 91956038 splice site probably benign
R1473:Hdac4 UTSW 1 92029968 missense possibly damaging 0.88
R1732:Hdac4 UTSW 1 91947535 missense probably benign 0.01
R1826:Hdac4 UTSW 1 91984699 missense probably damaging 1.00
R1987:Hdac4 UTSW 1 91934645 missense probably damaging 1.00
R2189:Hdac4 UTSW 1 91975522 missense probably null 0.00
R2384:Hdac4 UTSW 1 91984485 missense probably benign 0.02
R3705:Hdac4 UTSW 1 91934694 splice site probably benign
R3894:Hdac4 UTSW 1 91970968 missense possibly damaging 0.95
R4440:Hdac4 UTSW 1 91945995 missense probably damaging 1.00
R5075:Hdac4 UTSW 1 91996120 missense probably benign 0.00
R5431:Hdac4 UTSW 1 91972790 nonsense probably null
R5505:Hdac4 UTSW 1 91975465 missense probably benign
R5854:Hdac4 UTSW 1 91959421 missense probably damaging 1.00
R6018:Hdac4 UTSW 1 91958398 missense probably damaging 1.00
R6164:Hdac4 UTSW 1 92030154 missense probably benign 0.04
R6239:Hdac4 UTSW 1 92054972 missense probably benign 0.17
R6247:Hdac4 UTSW 1 92012838 intron probably null
R6306:Hdac4 UTSW 1 91996174 missense probably benign 0.00
R6381:Hdac4 UTSW 1 91984525 missense possibly damaging 0.67
R6450:Hdac4 UTSW 1 91984711 missense possibly damaging 0.81
R6504:Hdac4 UTSW 1 91968455 missense possibly damaging 0.88
R6639:Hdac4 UTSW 1 91970948 missense probably damaging 1.00
R6799:Hdac4 UTSW 1 92002213 missense probably damaging 0.98
R6910:Hdac4 UTSW 1 91982153 missense probably damaging 1.00
R7002:Hdac4 UTSW 1 91968361 missense possibly damaging 0.85
R7781:Hdac4 UTSW 1 91975665 missense probably benign 0.41
Z1177:Hdac4 UTSW 1 91956047 missense probably damaging 1.00
Z1177:Hdac4 UTSW 1 91987611 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCTCACACAGCAAGCTGTCTC -3'
(R):5'- CAAGAACCAGTTCTGCTCTGTTCCC -3'

Sequencing Primer
(F):5'- acagcaatagaaaaggaaccaag -3'
(R):5'- TGACTTAGCTCTGCTCCACT -3'
Posted On2013-04-16