Incidental Mutation 'R2361:Lce1k'
ID247143
Institutional Source Beutler Lab
Gene Symbol Lce1k
Ensembl Gene ENSMUSG00000095870
Gene Namelate cornified envelope 1K
SynonymsGm7055, Sprrl6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R2361 (G1)
Quality Score189
Status Not validated
Chromosome3
Chromosomal Location92806291-92807891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92806584 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 98 (S98C)
Ref Sequence ENSEMBL: ENSMUSP00000137052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179917]
Predicted Effect unknown
Transcript: ENSMUST00000179917
AA Change: S98C
SMART Domains Protein: ENSMUSP00000137052
Gene: ENSMUSG00000095870
AA Change: S98C

DomainStartEndE-ValueType
Pfam:LCE 22 62 3e-10 PFAM
Pfam:LCE 59 125 1.9e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G T 18: 70,469,575 Q56K probably damaging Het
Acrv1 A G 9: 36,698,550 N239S possibly damaging Het
Acss2 A G 2: 155,558,669 K543E probably damaging Het
Agbl3 A G 6: 34,832,505 D689G possibly damaging Het
Ass1 T C 2: 31,520,382 Y402H probably benign Het
Atr A G 9: 95,871,157 H683R probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Cacna1h C A 17: 25,384,012 V1445F probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Lrrc9 T C 12: 72,463,470 C448R possibly damaging Het
Map3k13 A G 16: 21,906,536 T420A probably benign Het
Megf8 A G 7: 25,348,954 D1684G possibly damaging Het
Nacad T C 11: 6,600,821 H790R probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Nt5e T C 9: 88,370,237 S551P possibly damaging Het
Ptgs2 T C 1: 150,103,975 V277A probably benign Het
Slc34a2 T A 5: 53,068,145 F411L probably benign Het
Slc4a1 T C 11: 102,356,830 Y409C probably damaging Het
Other mutations in Lce1k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02733:Lce1k APN 3 92806885 utr 5 prime probably benign
IGL03019:Lce1k APN 3 92806779 missense unknown
R1990:Lce1k UTSW 3 92806818 missense unknown
R1991:Lce1k UTSW 3 92806818 missense unknown
R1992:Lce1k UTSW 3 92806818 missense unknown
R2024:Lce1k UTSW 3 92806502 missense unknown
R2065:Lce1k UTSW 3 92806857 nonsense probably null
R2906:Lce1k UTSW 3 92806575 missense unknown
R4688:Lce1k UTSW 3 92806644 missense unknown
R4902:Lce1k UTSW 3 92806827 missense unknown
R7405:Lce1k UTSW 3 92806874 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- GGGAACAAATTCTGAATCTCCACAG -3'
(R):5'- ATCTTCCTGCTGTAGCCTGG -3'

Sequencing Primer
(F):5'- TGTAGTGACCTACGCTTGAAAC -3'
(R):5'- CCTGCTGTAGCCTGGGTTCTG -3'
Posted On2014-10-30