Mutagenetix > Incidental Mutation

Incidental Mutation 'R2361:Acrv1'

247150

Institutional Source

Beutler Lab

Gene Symbol

Acrv1

Ensembl Gene

ENSMUSG00000032110

Gene Name

acrosomal vesicle protein 1

Synonyms

Msa63, SP-10

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R2361 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36604550-36610139 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 36609846 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 239 (N239S)

Ref Sequence

ENSEMBL: ENSMUSP00000034620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034620]

AlphaFold

P50289

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034620
AA Change: N239S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000034620
Gene: ENSMUSG00000032110
AA Change: N239S

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	66	100	N/A	INTRINSIC
low complexity region	104	130	N/A	INTRINSIC
low complexity region	135	147	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184160

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a testis-specific, differentiation antigen, acrosomal vesicle protein 1, that arises within the acrosomal vesicle during spermatogenesis, and is associated with the acrosomal membranes and matrix of mature sperm. The acrosomal vesicle protein 1 may be involved in sperm-zona binding or penetration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	G	T	18: 70,602,646 (GRCm39)	Q56K	probably damaging	Het
Acss2	A	G	2: 155,400,589 (GRCm39)	K543E	probably damaging	Het
Agbl3	A	G	6: 34,809,440 (GRCm39)	D689G	possibly damaging	Het
Ass1	T	C	2: 31,410,394 (GRCm39)	Y402H	probably benign	Het
Atr	A	G	9: 95,753,210 (GRCm39)	H683R	probably benign	Het
Bbs10	A	G	10: 111,136,995 (GRCm39)	K703E	probably benign	Het
Cacna1h	C	A	17: 25,602,986 (GRCm39)	V1445F	probably damaging	Het
Dab1	C	T	4: 104,588,948 (GRCm39)	A524V	probably benign	Het
Lce1k	T	A	3: 92,713,891 (GRCm39)	S98C	unknown	Het
Lrrc9	T	C	12: 72,510,244 (GRCm39)	C448R	possibly damaging	Het
Map3k13	A	G	16: 21,725,286 (GRCm39)	T420A	probably benign	Het
Megf8	A	G	7: 25,048,379 (GRCm39)	D1684G	possibly damaging	Het
Nacad	T	C	11: 6,550,821 (GRCm39)	H790R	probably benign	Het
Nsd1	A	G	13: 55,361,524 (GRCm39)	D164G	possibly damaging	Het
Nt5e	T	C	9: 88,252,290 (GRCm39)	S551P	possibly damaging	Het
Ptgs2	T	C	1: 149,979,726 (GRCm39)	V277A	probably benign	Het
Slc34a2	T	A	5: 53,225,487 (GRCm39)	F411L	probably benign	Het
Slc4a1	T	C	11: 102,247,656 (GRCm39)	Y409C	probably damaging	Het

Other mutations in Acrv1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00707:Acrv1	APN	9	36,607,904 (GRCm39)	missense	possibly damaging	0.92
IGL00934:Acrv1	APN	9	36,605,688 (GRCm39)	missense	possibly damaging	0.66
IGL01325:Acrv1	APN	9	36,609,810 (GRCm39)	missense	probably benign	0.04
R1710:Acrv1	UTSW	9	36,605,551 (GRCm39)	nonsense	probably null
R4959:Acrv1	UTSW	9	36,605,996 (GRCm39)	critical splice donor site	probably null
R5570:Acrv1	UTSW	9	36,605,577 (GRCm39)	missense	probably damaging	1.00
R8890:Acrv1	UTSW	9	36,604,608 (GRCm39)	start codon destroyed	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TAATGGCAGAGTAGCATGGTC -3'
(R):5'- AGAGCCCGATGTGATTAGTTG -3'

Sequencing Primer
(F):5'- TCAAGTGAAAATGATGAGCTTGGTG -3'
(R):5'- AGCCCGATGTGATTAGTTGTTGAAG -3'

Posted On

2014-10-30