Incidental Mutation 'R2361:Nt5e'
ID247151
Institutional Source Beutler Lab
Gene Symbol Nt5e
Ensembl Gene ENSMUSG00000032420
Gene Name5' nucleotidase, ecto
Synonymsecto-5'-nucleotidase, CD73, Nt5, 2210401F01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2361 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location88327197-88372092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88370237 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 551 (S551P)
Ref Sequence ENSEMBL: ENSMUSP00000034992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034992]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034992
AA Change: S551P

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034992
Gene: ENSMUSG00000032420
AA Change: S551P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Metallophos 31 248 2.1e-15 PFAM
Pfam:5_nucleotid_C 340 515 4.9e-45 PFAM
transmembrane domain 553 575 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187166
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a membrane-bound nucleotidase that hydrolyzes extracellular nucleoside monophosphates. The encoded preproprotein undergoes proteolytic processing to generate to a functional, homodimeric enzyme that preferentially uses adenosine monophosphate as a substrate to generate free adenosine. Mice lacking the encoded protein exhibit a significantly reduced fall in stop flow pressure and superficial nephron glomerular filtration rate in response to a saturating increase of tubular perfusion flow. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mice for one allele are viable and fertile with increased circulating alkaline phosphatase and impaired tubuloglomerular feedback regulation. Homozygous null mice for a second allele display increased vascular permeability especially under hypoxic conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G T 18: 70,469,575 Q56K probably damaging Het
Acrv1 A G 9: 36,698,550 N239S possibly damaging Het
Acss2 A G 2: 155,558,669 K543E probably damaging Het
Agbl3 A G 6: 34,832,505 D689G possibly damaging Het
Ass1 T C 2: 31,520,382 Y402H probably benign Het
Atr A G 9: 95,871,157 H683R probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Cacna1h C A 17: 25,384,012 V1445F probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Lce1k T A 3: 92,806,584 S98C unknown Het
Lrrc9 T C 12: 72,463,470 C448R possibly damaging Het
Map3k13 A G 16: 21,906,536 T420A probably benign Het
Megf8 A G 7: 25,348,954 D1684G possibly damaging Het
Nacad T C 11: 6,600,821 H790R probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Ptgs2 T C 1: 150,103,975 V277A probably benign Het
Slc34a2 T A 5: 53,068,145 F411L probably benign Het
Slc4a1 T C 11: 102,356,830 Y409C probably damaging Het
Other mutations in Nt5e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01794:Nt5e APN 9 88367298 missense probably damaging 0.97
IGL02015:Nt5e APN 9 88367237 missense probably damaging 1.00
IGL02351:Nt5e APN 9 88327893 missense probably damaging 1.00
IGL02358:Nt5e APN 9 88327893 missense probably damaging 1.00
IGL02826:Nt5e APN 9 88355705 missense probably damaging 0.97
IGL03237:Nt5e APN 9 88355734 missense probably damaging 1.00
R0092:Nt5e UTSW 9 88370285 missense probably benign 0.00
R0238:Nt5e UTSW 9 88367332 missense possibly damaging 0.81
R0238:Nt5e UTSW 9 88367332 missense possibly damaging 0.81
R0557:Nt5e UTSW 9 88366466 missense probably damaging 1.00
R1727:Nt5e UTSW 9 88328029 missense possibly damaging 0.87
R1834:Nt5e UTSW 9 88370187 missense probably damaging 1.00
R3871:Nt5e UTSW 9 88364693 missense probably benign 0.04
R4990:Nt5e UTSW 9 88355593 missense probably benign 0.03
R5039:Nt5e UTSW 9 88363581 missense probably benign 0.00
R5642:Nt5e UTSW 9 88327687 start codon destroyed probably null 0.02
R5812:Nt5e UTSW 9 88369055 missense probably damaging 1.00
R6389:Nt5e UTSW 9 88363471 missense probably damaging 1.00
R7003:Nt5e UTSW 9 88364752 missense probably damaging 1.00
R8325:Nt5e UTSW 9 88363562 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCTGGAACATGAAAGTGCAATC -3'
(R):5'- GAGTGCTGTTACAAAGCCAGG -3'

Sequencing Primer
(F):5'- ACCAGCATTTTTGTCTTCTGAGATG -3'
(R):5'- TGTTACAAAGCCAGGTCTCCAGAG -3'
Posted On2014-10-30