Mutagenetix > Incidental Mutation

Incidental Mutation 'R2361:Nacad'

247154

Institutional Source

Beutler Lab

Gene Symbol

Nacad

Ensembl Gene

ENSMUSG00000041073

Gene Name

NAC alpha domain containing

Synonyms

mKIAA0363

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2361 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

6597823-6606053 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 6600821 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 790 (H790R)

Ref Sequence

ENSEMBL: ENSMUSP00000049490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000388] [ENSMUST00000045713] [ENSMUST00000109721] [ENSMUST00000109722]

AlphaFold

Q5SWP3

Predicted Effect

probably benign
Transcript: ENSMUST00000000388

SMART Domains

Protein: ENSMUSP00000000388
Gene: ENSMUSG00000000378

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Blast:PTB	60	230	2e-35	BLAST
low complexity region	242	252	N/A	INTRINSIC
Pfam:CCM2_C	296	396	8.9e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000045713
AA Change: H790R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000049490
Gene: ENSMUSG00000041073
AA Change: H790R

Domain	Start	End	E-Value	Type
low complexity region	2	28	N/A	INTRINSIC
low complexity region	70	87	N/A	INTRINSIC
low complexity region	228	235	N/A	INTRINSIC
low complexity region	266	277	N/A	INTRINSIC
low complexity region	294	306	N/A	INTRINSIC
low complexity region	328	354	N/A	INTRINSIC
low complexity region	391	422	N/A	INTRINSIC
low complexity region	454	479	N/A	INTRINSIC
internal_repeat_1	537	689	6.19e-8	PROSPERO
low complexity region	692	713	N/A	INTRINSIC
internal_repeat_1	732	889	6.19e-8	PROSPERO
low complexity region	924	939	N/A	INTRINSIC
low complexity region	1159	1170	N/A	INTRINSIC
low complexity region	1308	1325	N/A	INTRINSIC
Pfam:NAC	1357	1413	2.9e-24	PFAM
low complexity region	1449	1466	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109721

SMART Domains

Protein: ENSMUSP00000105343
Gene: ENSMUSG00000000378

Domain	Start	End	E-Value	Type
Blast:PTB	2	166	2e-32	BLAST
low complexity region	178	188	N/A	INTRINSIC
low complexity region	230	244	N/A	INTRINSIC
PDB:4FQN\|D	245	324	5e-52	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000109722

SMART Domains

Protein: ENSMUSP00000105344
Gene: ENSMUSG00000000378

Domain	Start	End	E-Value	Type
Blast:PTB	2	166	2e-32	BLAST
low complexity region	178	188	N/A	INTRINSIC
low complexity region	230	244	N/A	INTRINSIC
PDB:4FQN\|D	245	324	5e-52	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000177050

Predicted Effect

probably benign
Transcript: ENSMUST00000177391

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	G	T	18: 70,469,575	Q56K	probably damaging	Het
Acrv1	A	G	9: 36,698,550	N239S	possibly damaging	Het
Acss2	A	G	2: 155,558,669	K543E	probably damaging	Het
Agbl3	A	G	6: 34,832,505	D689G	possibly damaging	Het
Ass1	T	C	2: 31,520,382	Y402H	probably benign	Het
Atr	A	G	9: 95,871,157	H683R	probably benign	Het
Bbs10	A	G	10: 111,301,134	K703E	probably benign	Het
Cacna1h	C	A	17: 25,384,012	V1445F	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Lce1k	T	A	3: 92,806,584	S98C	unknown	Het
Lrrc9	T	C	12: 72,463,470	C448R	possibly damaging	Het
Map3k13	A	G	16: 21,906,536	T420A	probably benign	Het
Megf8	A	G	7: 25,348,954	D1684G	possibly damaging	Het
Nsd1	A	G	13: 55,213,711	D164G	possibly damaging	Het
Nt5e	T	C	9: 88,370,237	S551P	possibly damaging	Het
Ptgs2	T	C	1: 150,103,975	V277A	probably benign	Het
Slc34a2	T	A	5: 53,068,145	F411L	probably benign	Het
Slc4a1	T	C	11: 102,356,830	Y409C	probably damaging	Het

Other mutations in Nacad

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00597:Nacad	APN	11	6600921	missense	probably benign	0.24
IGL00903:Nacad	APN	11	6600632	missense	probably damaging	0.99
IGL01303:Nacad	APN	11	6598279	missense	possibly damaging	0.81
IGL01353:Nacad	APN	11	6600530	missense	possibly damaging	0.70
IGL01833:Nacad	APN	11	6605700	missense	unknown
IGL02267:Nacad	APN	11	6602649	missense	probably benign	0.14
IGL02531:Nacad	APN	11	6598580	missense	possibly damaging	0.90
IGL02994:Nacad	APN	11	6599528	missense	possibly damaging	0.83
IGL03121:Nacad	APN	11	6600933	missense	probably damaging	0.98
IGL03161:Nacad	APN	11	6600378	nonsense	probably null
Locusta	UTSW	11	6602387	missense	possibly damaging	0.88
migratoria	UTSW	11	6601196	missense	probably benign	0.30
FR4340:Nacad	UTSW	11	6599761	small insertion	probably benign
FR4342:Nacad	UTSW	11	6599762	small insertion	probably benign
FR4548:Nacad	UTSW	11	6599752	small insertion	probably benign
FR4548:Nacad	UTSW	11	6599760	small insertion	probably benign
FR4589:Nacad	UTSW	11	6599753	small insertion	probably benign
FR4976:Nacad	UTSW	11	6599749	small insertion	probably benign
FR4976:Nacad	UTSW	11	6599756	small insertion	probably benign
FR4976:Nacad	UTSW	11	6599763	small insertion	probably benign
PIT4402001:Nacad	UTSW	11	6598621	missense	probably benign	0.19
R0330:Nacad	UTSW	11	6600903	missense	probably benign
R0331:Nacad	UTSW	11	6599441	missense	possibly damaging	0.84
R0409:Nacad	UTSW	11	6599810	missense	probably benign	0.00
R0612:Nacad	UTSW	11	6601382	missense	possibly damaging	0.90
R0644:Nacad	UTSW	11	6599486	missense	possibly damaging	0.69
R0829:Nacad	UTSW	11	6601158	missense	probably benign	0.18
R1483:Nacad	UTSW	11	6602217	missense	probably damaging	0.99
R1583:Nacad	UTSW	11	6601185	missense	probably benign	0.08
R1905:Nacad	UTSW	11	6602540	missense	probably benign	0.15
R1907:Nacad	UTSW	11	6602540	missense	probably benign	0.15
R2979:Nacad	UTSW	11	6601424	missense	probably benign	0.06
R4192:Nacad	UTSW	11	6605534	missense	probably benign	0.44
R4381:Nacad	UTSW	11	6600204	missense	probably benign	0.18
R4539:Nacad	UTSW	11	6600677	missense	possibly damaging	0.94
R4751:Nacad	UTSW	11	6605726	missense	unknown
R4944:Nacad	UTSW	11	6598507	missense	possibly damaging	0.95
R4962:Nacad	UTSW	11	6599169	missense	probably damaging	1.00
R5102:Nacad	UTSW	11	6598528	missense	probably damaging	1.00
R5189:Nacad	UTSW	11	6601611	missense	probably damaging	0.98
R5296:Nacad	UTSW	11	6605745	missense	unknown
R5566:Nacad	UTSW	11	6602136	missense	probably damaging	1.00
R5634:Nacad	UTSW	11	6602387	missense	possibly damaging	0.88
R5725:Nacad	UTSW	11	6601643	missense	probably benign	0.15
R5748:Nacad	UTSW	11	6598370	nonsense	probably null
R5864:Nacad	UTSW	11	6600581	missense	probably benign
R5882:Nacad	UTSW	11	6598568	missense	possibly damaging	0.95
R6089:Nacad	UTSW	11	6601331	missense	probably benign	0.03
R6117:Nacad	UTSW	11	6599810	missense	probably benign	0.00
R6161:Nacad	UTSW	11	6600902	missense	probably benign
R6351:Nacad	UTSW	11	6599235	missense	probably damaging	1.00
R6351:Nacad	UTSW	11	6600165	nonsense	probably null
R6366:Nacad	UTSW	11	6601196	missense	probably benign	0.30
R6525:Nacad	UTSW	11	6602255	missense	probably damaging	1.00
R6811:Nacad	UTSW	11	6599400	missense	possibly damaging	0.66
R6931:Nacad	UTSW	11	6601877	missense	probably benign	0.14
R6966:Nacad	UTSW	11	6602634	missense	possibly damaging	0.93
R7228:Nacad	UTSW	11	6598412	missense	probably benign	0.19
R7248:Nacad	UTSW	11	6598589	nonsense	probably null
R7556:Nacad	UTSW	11	6601272	missense	possibly damaging	0.90
R7594:Nacad	UTSW	11	6602457	missense	probably damaging	0.99
R7813:Nacad	UTSW	11	6599071	missense	probably benign	0.38
R7841:Nacad	UTSW	11	6601031	missense	probably benign	0.00
R8243:Nacad	UTSW	11	6602643	missense	probably damaging	0.96
R8810:Nacad	UTSW	11	6602853	missense	probably benign	0.15
R9042:Nacad	UTSW	11	6598948	missense	possibly damaging	0.95
R9057:Nacad	UTSW	11	6600876	missense	possibly damaging	0.53
R9114:Nacad	UTSW	11	6602252	missense	probably damaging	1.00
R9328:Nacad	UTSW	11	6602417	missense	possibly damaging	0.84
R9394:Nacad	UTSW	11	6599390	missense	probably damaging	1.00
R9595:Nacad	UTSW	11	6601790	missense	probably damaging	0.99
R9755:Nacad	UTSW	11	6599374	critical splice donor site	probably null
R9760:Nacad	UTSW	11	6601662	missense	probably benign	0.02
T0975:Nacad	UTSW	11	6599750	small insertion	probably benign
T0975:Nacad	UTSW	11	6601622	missense	probably benign	0.03
T0975:Nacad	UTSW	11	6601632	missense	probably benign	0.17
X0011:Nacad	UTSW	11	6601074	missense	probably benign	0.00
Z1176:Nacad	UTSW	11	6602297	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGTGGCAATCCCTTCATC -3'
(R):5'- GTGGCTACATATGAGTTCCAGCG -3'

Sequencing Primer
(F):5'- AATCCCTTCATCCTGCTGGG -3'
(R):5'- CTACATATGAGTTCCAGCGGGCTAAG -3'

Posted On

2014-10-30