Incidental Mutation 'R2361:Slc4a1'
ID 247155
Institutional Source Beutler Lab
Gene Symbol Slc4a1
Ensembl Gene ENSMUSG00000006574
Gene Name solute carrier family 4 (anion exchanger), member 1
Synonyms band 3, CD233, Ae1, erythrocyte membrane protein band 3, l11Jus51, Empb3
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2361 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 102239646-102256107 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102247656 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 409 (Y409C)
Ref Sequence ENSEMBL: ENSMUSP00000006749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006749]
AlphaFold P04919
Predicted Effect probably damaging
Transcript: ENSMUST00000006749
AA Change: Y409C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006749
Gene: ENSMUSG00000006574
AA Change: Y409C

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Pfam:Band_3_cyto 100 342 1.6e-81 PFAM
Pfam:HCO3_cotransp 391 584 5.7e-85 PFAM
Pfam:HCO3_cotransp 575 857 5.6e-118 PFAM
transmembrane domain 875 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151050
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations exhibit retarded growth, severe spherocytosis, hemolytic anemia, lack of erythrocyte glycophorin A, mitotic defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G T 18: 70,602,646 (GRCm39) Q56K probably damaging Het
Acrv1 A G 9: 36,609,846 (GRCm39) N239S possibly damaging Het
Acss2 A G 2: 155,400,589 (GRCm39) K543E probably damaging Het
Agbl3 A G 6: 34,809,440 (GRCm39) D689G possibly damaging Het
Ass1 T C 2: 31,410,394 (GRCm39) Y402H probably benign Het
Atr A G 9: 95,753,210 (GRCm39) H683R probably benign Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
Cacna1h C A 17: 25,602,986 (GRCm39) V1445F probably damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Lce1k T A 3: 92,713,891 (GRCm39) S98C unknown Het
Lrrc9 T C 12: 72,510,244 (GRCm39) C448R possibly damaging Het
Map3k13 A G 16: 21,725,286 (GRCm39) T420A probably benign Het
Megf8 A G 7: 25,048,379 (GRCm39) D1684G possibly damaging Het
Nacad T C 11: 6,550,821 (GRCm39) H790R probably benign Het
Nsd1 A G 13: 55,361,524 (GRCm39) D164G possibly damaging Het
Nt5e T C 9: 88,252,290 (GRCm39) S551P possibly damaging Het
Ptgs2 T C 1: 149,979,726 (GRCm39) V277A probably benign Het
Slc34a2 T A 5: 53,225,487 (GRCm39) F411L probably benign Het
Other mutations in Slc4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc4a1 APN 11 102,248,790 (GRCm39) missense probably benign 0.09
IGL01845:Slc4a1 APN 11 102,244,729 (GRCm39) missense probably benign 0.01
IGL02166:Slc4a1 APN 11 102,245,159 (GRCm39) missense probably damaging 1.00
IGL02745:Slc4a1 APN 11 102,247,093 (GRCm39) missense probably damaging 1.00
IGL02801:Slc4a1 APN 11 102,249,972 (GRCm39) critical splice acceptor site probably null
Rumor UTSW 11 102,252,048 (GRCm39) nonsense probably null
A5278:Slc4a1 UTSW 11 102,244,641 (GRCm39) splice site probably benign
R0011:Slc4a1 UTSW 11 102,247,936 (GRCm39) missense possibly damaging 0.51
R0193:Slc4a1 UTSW 11 102,243,510 (GRCm39) missense possibly damaging 0.91
R0445:Slc4a1 UTSW 11 102,245,192 (GRCm39) missense probably benign 0.04
R0599:Slc4a1 UTSW 11 102,248,741 (GRCm39) splice site probably benign
R0635:Slc4a1 UTSW 11 102,243,498 (GRCm39) missense possibly damaging 0.78
R1496:Slc4a1 UTSW 11 102,251,997 (GRCm39) missense probably benign
R1816:Slc4a1 UTSW 11 102,242,056 (GRCm39) missense probably damaging 1.00
R1898:Slc4a1 UTSW 11 102,241,133 (GRCm39) missense probably damaging 1.00
R2381:Slc4a1 UTSW 11 102,250,128 (GRCm39) missense probably benign 0.00
R3806:Slc4a1 UTSW 11 102,248,019 (GRCm39) missense probably benign 0.00
R3857:Slc4a1 UTSW 11 102,247,947 (GRCm39) missense probably benign 0.01
R3858:Slc4a1 UTSW 11 102,247,947 (GRCm39) missense probably benign 0.01
R4585:Slc4a1 UTSW 11 102,252,245 (GRCm39) utr 5 prime probably benign
R4586:Slc4a1 UTSW 11 102,252,245 (GRCm39) utr 5 prime probably benign
R4705:Slc4a1 UTSW 11 102,247,084 (GRCm39) missense possibly damaging 0.89
R4914:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4915:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4916:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4918:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R5001:Slc4a1 UTSW 11 102,242,329 (GRCm39) missense probably benign 0.12
R5103:Slc4a1 UTSW 11 102,244,087 (GRCm39) missense possibly damaging 0.65
R5234:Slc4a1 UTSW 11 102,252,209 (GRCm39) missense probably benign 0.03
R5308:Slc4a1 UTSW 11 102,249,903 (GRCm39) missense probably damaging 0.98
R5315:Slc4a1 UTSW 11 102,249,080 (GRCm39) missense possibly damaging 0.77
R5478:Slc4a1 UTSW 11 102,241,140 (GRCm39) missense probably damaging 0.98
R5521:Slc4a1 UTSW 11 102,244,092 (GRCm39) missense probably benign 0.01
R5888:Slc4a1 UTSW 11 102,247,351 (GRCm39) missense probably damaging 0.98
R6011:Slc4a1 UTSW 11 102,243,357 (GRCm39) missense probably damaging 1.00
R6547:Slc4a1 UTSW 11 102,247,561 (GRCm39) missense probably damaging 0.99
R6629:Slc4a1 UTSW 11 102,252,048 (GRCm39) nonsense probably null
R6717:Slc4a1 UTSW 11 102,245,249 (GRCm39) missense probably damaging 0.99
R7051:Slc4a1 UTSW 11 102,247,084 (GRCm39) missense probably benign 0.12
R7103:Slc4a1 UTSW 11 102,244,693 (GRCm39) missense probably damaging 0.97
R7315:Slc4a1 UTSW 11 102,247,310 (GRCm39) missense probably damaging 1.00
R7331:Slc4a1 UTSW 11 102,252,245 (GRCm39) start gained probably benign
R7582:Slc4a1 UTSW 11 102,243,403 (GRCm39) missense probably damaging 0.99
R8560:Slc4a1 UTSW 11 102,244,083 (GRCm39) missense possibly damaging 0.94
R9036:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R9274:Slc4a1 UTSW 11 102,242,047 (GRCm39) missense probably benign 0.00
R9502:Slc4a1 UTSW 11 102,247,674 (GRCm39) missense probably damaging 0.97
R9568:Slc4a1 UTSW 11 102,247,680 (GRCm39) missense probably damaging 1.00
R9585:Slc4a1 UTSW 11 102,247,915 (GRCm39) missense probably benign 0.08
R9651:Slc4a1 UTSW 11 102,242,256 (GRCm39) missense probably damaging 1.00
RF006:Slc4a1 UTSW 11 102,247,542 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGCAGAGCATCAGATTGG -3'
(R):5'- AGGTACACGGACAAGGTTTC -3'

Sequencing Primer
(F):5'- CTGCAGAGCATCAGATTGGTTCAG -3'
(R):5'- AAGGTTTCTTGATTCCCCCATGG -3'
Posted On 2014-10-30