Incidental Mutation 'R0288:Rif1'
ID24716
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Namereplication timing regulatory factor 1
Synonyms6530403D07Rik, 5730435J01Rik, D2Ertd145e
MMRRC Submission 038507-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0288 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location52072832-52122383 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52110013 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1160 (S1160P)
Ref Sequence ENSEMBL: ENSMUSP00000108313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]
Predicted Effect probably damaging
Transcript: ENSMUST00000069794
AA Change: S1160P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: S1160P

DomainStartEndE-ValueType
Pfam:Rif1_N 22 368 3.3e-78 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112693
AA Change: S1160P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: S1160P

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125322
Predicted Effect probably benign
Transcript: ENSMUST00000125376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145130
Predicted Effect probably benign
Transcript: ENSMUST00000152178
Meta Mutation Damage Score 0.0984 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.7%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,039,940 E413G possibly damaging Het
Amigo2 G T 15: 97,245,679 N287K probably damaging Het
Ankle2 T A 5: 110,236,390 I260K probably damaging Het
Apob C T 12: 7,990,779 R635* probably null Het
Camkv A G 9: 107,946,356 Y153C probably damaging Het
Capn9 A G 8: 124,600,491 probably benign Het
Ces2c A G 8: 104,849,744 I130V probably benign Het
Cfap44 T A 16: 44,415,894 probably benign Het
Cfhr3 A G 1: 139,597,687 noncoding transcript Het
Chmp1a G T 8: 123,208,006 D70E probably damaging Het
Coil G A 11: 88,981,868 G352R probably damaging Het
Colq T C 14: 31,543,992 E188G possibly damaging Het
Cyfip2 A G 11: 46,253,972 F685S possibly damaging Het
Cyp4f39 A G 17: 32,492,436 N519S probably benign Het
Dennd1c A T 17: 57,076,870 probably null Het
Dnah9 A T 11: 66,025,134 probably null Het
Dnmbp T C 19: 43,902,459 T290A possibly damaging Het
Dsc2 T C 18: 20,033,120 D818G probably damaging Het
Gnptab G A 10: 88,433,105 V557I probably benign Het
Hdac4 A T 1: 91,971,006 H675Q probably damaging Het
Kcnk3 T C 5: 30,588,420 M35T probably benign Het
Kif1b A T 4: 149,199,338 I1290N probably damaging Het
Klhl14 G A 18: 21,565,563 R398W probably damaging Het
Marveld1 T C 19: 42,147,826 F60L probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Ndst3 A T 3: 123,672,194 V43D probably benign Het
Nhsl1 A G 10: 18,524,046 D306G probably damaging Het
Nlrp2 A G 7: 5,328,545 V284A probably benign Het
Pcdhb15 T C 18: 37,475,398 V561A probably damaging Het
Pdcl2 T C 5: 76,312,497 I177V possibly damaging Het
Pkd1l3 G A 8: 109,646,499 probably null Het
Pla2g6 A C 15: 79,286,906 probably benign Het
Plekhj1 A T 10: 80,796,610 I122N probably damaging Het
Pmel T C 10: 128,714,306 I70T probably benign Het
Psip1 T C 4: 83,464,959 D273G probably damaging Het
Rictor A G 15: 6,786,540 I1098V probably benign Het
Rsbn1l T C 5: 20,920,040 I255V probably damaging Het
Slc15a5 A G 6: 138,017,916 probably benign Het
Slc29a1 G A 17: 45,589,804 R111W probably damaging Het
Slc36a1 G A 11: 55,219,087 A74T probably damaging Het
Slc5a7 A T 17: 54,293,018 Y122* probably null Het
Slc6a3 G T 13: 73,560,928 G324W probably damaging Het
Sltm T C 9: 70,579,351 S433P probably damaging Het
Spta1 T C 1: 174,243,179 S2190P probably damaging Het
Sry A T Y: 2,662,818 F281I unknown Het
Stk32a T A 18: 43,304,995 probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbl3 G A 17: 24,701,807 H612Y probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Top2a A G 11: 99,016,423 probably benign Het
Usp9y A T Y: 1,333,606 probably benign Het
Vldlr G A 19: 27,240,651 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r28 A G 7: 5,488,021 L409P probably damaging Het
Vps13c T C 9: 67,927,366 V1659A probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp280d A T 9: 72,331,339 K646* probably null Het
Zfp36 A G 7: 28,378,241 S81P probably benign Het
Zfp618 A T 4: 63,132,934 T651S possibly damaging Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52121007 missense probably damaging 0.96
IGL00711:Rif1 APN 2 52111070 missense probably benign 0.00
IGL00721:Rif1 APN 2 52119117 missense probably damaging 1.00
IGL01085:Rif1 APN 2 52085140 missense possibly damaging 0.71
IGL01093:Rif1 APN 2 52095948 missense probably damaging 1.00
IGL01107:Rif1 APN 2 52111303 missense probably benign 0.00
IGL01138:Rif1 APN 2 52111522 missense probably damaging 1.00
IGL01844:Rif1 APN 2 52112543 missense probably benign 0.07
IGL02441:Rif1 APN 2 52105515 missense probably benign 0.00
IGL02448:Rif1 APN 2 52116696 missense probably damaging 0.99
IGL02563:Rif1 APN 2 52077065 missense probably damaging 1.00
IGL02704:Rif1 APN 2 52093576 missense probably damaging 1.00
IGL02946:Rif1 APN 2 52110125 nonsense probably null
IGL03060:Rif1 APN 2 52112137 missense probably damaging 0.97
IGL03206:Rif1 APN 2 52103622 missense probably damaging 1.00
IGL03263:Rif1 APN 2 52090261 missense probably damaging 0.99
IGL03267:Rif1 APN 2 52076988 missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52112599 missense probably benign 0.32
hifi UTSW 2 52110324 unclassified probably benign
nietzsche UTSW 2 52077020 missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52111958 missense
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0104:Rif1 UTSW 2 52110092 missense possibly damaging 0.77
R0268:Rif1 UTSW 2 52090286 critical splice donor site probably null
R0276:Rif1 UTSW 2 52110324 unclassified probably benign
R0278:Rif1 UTSW 2 52110324 unclassified probably benign
R0314:Rif1 UTSW 2 52110324 unclassified probably benign
R0345:Rif1 UTSW 2 52110324 unclassified probably benign
R0346:Rif1 UTSW 2 52110324 unclassified probably benign
R0383:Rif1 UTSW 2 52085141 missense probably damaging 0.96
R0384:Rif1 UTSW 2 52110324 unclassified probably benign
R0387:Rif1 UTSW 2 52110324 unclassified probably benign
R0388:Rif1 UTSW 2 52110324 unclassified probably benign
R0456:Rif1 UTSW 2 52110324 unclassified probably benign
R0477:Rif1 UTSW 2 52110324 unclassified probably benign
R0505:Rif1 UTSW 2 52110737 missense probably damaging 0.99
R0510:Rif1 UTSW 2 52110324 unclassified probably benign
R0511:Rif1 UTSW 2 52110324 unclassified probably benign
R0512:Rif1 UTSW 2 52110324 unclassified probably benign
R0633:Rif1 UTSW 2 52112563 missense probably benign 0.00
R0637:Rif1 UTSW 2 52110324 unclassified probably benign
R0638:Rif1 UTSW 2 52111588 missense probably benign 0.12
R0666:Rif1 UTSW 2 52110324 unclassified probably benign
R0675:Rif1 UTSW 2 52110324 unclassified probably benign
R0707:Rif1 UTSW 2 52110324 unclassified probably benign
R0726:Rif1 UTSW 2 52110353 missense possibly damaging 0.52
R0743:Rif1 UTSW 2 52110324 unclassified probably benign
R0744:Rif1 UTSW 2 52110324 unclassified probably benign
R0938:Rif1 UTSW 2 52110324 unclassified probably benign
R0939:Rif1 UTSW 2 52110324 unclassified probably benign
R0940:Rif1 UTSW 2 52110324 unclassified probably benign
R0941:Rif1 UTSW 2 52110324 unclassified probably benign
R0942:Rif1 UTSW 2 52110324 unclassified probably benign
R0943:Rif1 UTSW 2 52110324 unclassified probably benign
R1006:Rif1 UTSW 2 52085029 missense probably damaging 0.99
R1052:Rif1 UTSW 2 52111562 missense probably benign 0.01
R1061:Rif1 UTSW 2 52110324 unclassified probably benign
R1175:Rif1 UTSW 2 52107628 unclassified probably benign
R1183:Rif1 UTSW 2 52110324 unclassified probably benign
R1184:Rif1 UTSW 2 52110324 unclassified probably benign
R1271:Rif1 UTSW 2 52110324 unclassified probably benign
R1332:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1336:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1351:Rif1 UTSW 2 52111555 missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52110324 unclassified probably benign
R1527:Rif1 UTSW 2 52110324 unclassified probably benign
R1560:Rif1 UTSW 2 52111131 missense probably damaging 1.00
R1563:Rif1 UTSW 2 52073223 missense probably damaging 0.99
R1571:Rif1 UTSW 2 52110324 unclassified probably benign
R1625:Rif1 UTSW 2 52103640 missense probably benign 0.25
R1679:Rif1 UTSW 2 52110324 unclassified probably benign
R1689:Rif1 UTSW 2 52110324 unclassified probably benign
R1731:Rif1 UTSW 2 52110324 unclassified probably benign
R1744:Rif1 UTSW 2 52112392 missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52110324 unclassified probably benign
R1748:Rif1 UTSW 2 52110324 unclassified probably benign
R1831:Rif1 UTSW 2 52078495 nonsense probably null
R1902:Rif1 UTSW 2 52116673 missense possibly damaging 0.93
R1964:Rif1 UTSW 2 52098409 missense probably benign 0.01
R1978:Rif1 UTSW 2 52110324 unclassified probably benign
R2000:Rif1 UTSW 2 52081298 missense probably damaging 0.99
R2030:Rif1 UTSW 2 52092346 missense probably damaging 1.00
R2056:Rif1 UTSW 2 52093576 missense probably damaging 1.00
R2106:Rif1 UTSW 2 52110324 unclassified probably benign
R2109:Rif1 UTSW 2 52110324 unclassified probably benign
R2125:Rif1 UTSW 2 52110324 unclassified probably benign
R2126:Rif1 UTSW 2 52110324 unclassified probably benign
R2145:Rif1 UTSW 2 52111400 missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52110324 unclassified probably benign
R2153:Rif1 UTSW 2 52110324 unclassified probably benign
R2213:Rif1 UTSW 2 52110324 unclassified probably benign
R2327:Rif1 UTSW 2 52110324 unclassified probably benign
R2512:Rif1 UTSW 2 52110324 unclassified probably benign
R2513:Rif1 UTSW 2 52110324 unclassified probably benign
R2516:Rif1 UTSW 2 52110324 unclassified probably benign
R2520:Rif1 UTSW 2 52110324 unclassified probably benign
R2905:Rif1 UTSW 2 52098504 missense probably damaging 0.99
R3005:Rif1 UTSW 2 52082764 missense probably damaging 1.00
R3155:Rif1 UTSW 2 52110324 unclassified probably benign
R3156:Rif1 UTSW 2 52110324 unclassified probably benign
R3429:Rif1 UTSW 2 52110324 unclassified probably benign
R3707:Rif1 UTSW 2 52093580 missense probably damaging 1.00
R3907:Rif1 UTSW 2 52112545 missense probably benign 0.03
R3978:Rif1 UTSW 2 52116747 critical splice donor site probably null
R4023:Rif1 UTSW 2 52121087 missense probably benign 0.01
R4052:Rif1 UTSW 2 52098471 nonsense probably null
R4668:Rif1 UTSW 2 52111952 missense probably benign 0.01
R4674:Rif1 UTSW 2 52106942 missense probably null 1.00
R4715:Rif1 UTSW 2 52073139 utr 5 prime probably benign
R4766:Rif1 UTSW 2 52098934 missense probably damaging 1.00
R4783:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4785:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4869:Rif1 UTSW 2 52093611 intron probably benign
R4911:Rif1 UTSW 2 52110518 missense probably damaging 0.98
R4951:Rif1 UTSW 2 52084986 intron probably null
R5044:Rif1 UTSW 2 52109928 missense probably damaging 0.99
R5088:Rif1 UTSW 2 52092295 missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52120309 missense probably damaging 1.00
R5187:Rif1 UTSW 2 52081289 missense probably damaging 1.00
R5222:Rif1 UTSW 2 52077020 missense probably benign 0.08
R5243:Rif1 UTSW 2 52111824 missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52120971 intron probably benign
R5476:Rif1 UTSW 2 52089595 missense probably damaging 1.00
R5496:Rif1 UTSW 2 52098916 missense probably damaging 1.00
R5641:Rif1 UTSW 2 52121158 missense possibly damaging 0.80
R5883:Rif1 UTSW 2 52105639 critical splice donor site probably null
R5987:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5990:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5992:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6019:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6020:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6255:Rif1 UTSW 2 52085053 missense probably damaging 1.00
R6342:Rif1 UTSW 2 52119156 missense probably damaging 0.97
R6364:Rif1 UTSW 2 52107669 missense probably damaging 0.97
R6747:Rif1 UTSW 2 52078263 intron probably null
R6928:Rif1 UTSW 2 52095961 missense probably damaging 1.00
R6954:Rif1 UTSW 2 52112691 missense probably benign 0.00
R7003:Rif1 UTSW 2 52076989 missense probably benign 0.06
R7310:Rif1 UTSW 2 52105619 missense probably benign 0.12
R7549:Rif1 UTSW 2 52078507 missense possibly damaging 0.52
R7603:Rif1 UTSW 2 52076175 missense probably damaging 1.00
R7673:Rif1 UTSW 2 52088654 missense probably damaging 1.00
R7741:Rif1 UTSW 2 52085141 missense probably damaging 0.96
R7777:Rif1 UTSW 2 52116356 missense probably benign 0.00
R7910:Rif1 UTSW 2 52078387 nonsense probably null
R7991:Rif1 UTSW 2 52078387 nonsense probably null
X0064:Rif1 UTSW 2 52074315 missense probably benign 0.00
X0064:Rif1 UTSW 2 52094633 missense probably damaging 0.96
Z1177:Rif1 UTSW 2 52088648 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCTAACGTGACCTCCCACGTCTT -3'
(R):5'- AGTAACTGACTGCTCAGCTTTACTCCA -3'

Sequencing Primer
(F):5'- TCACAGTTAGTACCTGTACCAGAG -3'
(R):5'- AAGGTCTAGTTTCTGAGCCATC -3'
Posted On2013-04-16