Incidental Mutation 'R2362:Thbd'
ID 247163
Institutional Source Beutler Lab
Gene Symbol Thbd
Ensembl Gene ENSMUSG00000074743
Gene Name thrombomodulin
Synonyms CD141, TM
MMRRC Submission 040343-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2362 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 148404466-148408188 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 148406364 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 528 (L528P)
Ref Sequence ENSEMBL: ENSMUSP00000096877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099270]
AlphaFold P15306
Predicted Effect probably damaging
Transcript: ENSMUST00000099270
AA Change: L528P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096877
Gene: ENSMUSG00000074743
AA Change: L528P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
CLECT 24 166 2.78e-18 SMART
EGF 243 280 2.2e1 SMART
EGF 286 323 1.47e-3 SMART
EGF_CA 324 362 7.81e-8 SMART
EGF 367 404 3.57e-2 SMART
EGF 406 439 2.53e1 SMART
EGF 443 480 2.39e1 SMART
low complexity region 490 511 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Meta Mutation Damage Score 0.5919 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene is an endothelial-specific type I membrane receptor that binds thrombin. This binding results in the activation of protein C, which degrades clotting factors Va and VIIIa and reduces the amount of thrombin generated. Mutations in this gene are a cause of thromboembolic disease, also known as inherited thrombophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants are growth retarded and die by embryonic day 9.5. Embryos develop further in vitro than in vivo suggesting maternal-fetal incompatibility. Endothelial cell-specific, conditional knockouts suffer fatal juvenile thromboses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Aadat A G 8: 60,532,298 probably benign Het
Acsm5 T C 7: 119,528,426 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Cdr2 T G 7: 120,970,331 I62L possibly damaging Het
Clk3 T C 9: 57,754,619 I382V possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fam160b2 A G 14: 70,586,365 Y568H probably benign Het
Fxyd5 T C 7: 31,036,471 N104S probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Ift122 A G 6: 115,884,350 D193G probably damaging Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Olfr1477 A T 19: 13,502,508 H55L probably damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Polr3e C G 7: 120,942,564 D623E probably damaging Het
Rapgef6 T C 11: 54,694,272 Y1494H probably damaging Het
Rbm14 T C 19: 4,801,707 probably benign Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Slc10a7 A G 8: 78,509,632 I20V probably damaging Het
Sort1 C T 3: 108,346,665 T549I possibly damaging Het
Stambpl1 G A 19: 34,236,354 V328I probably benign Het
Wbp11 A T 6: 136,824,332 M63K probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Thbd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Thbd APN 2 148407682 nonsense probably null
IGL01510:Thbd APN 2 148406974 missense probably damaging 1.00
IGL01845:Thbd APN 2 148407096 missense probably benign
IGL01892:Thbd APN 2 148407068 missense possibly damaging 0.68
IGL02039:Thbd APN 2 148406542 missense probably benign 0.05
IGL02261:Thbd APN 2 148406481 missense probably benign
IGL02941:Thbd APN 2 148407034 missense probably damaging 1.00
IGL03110:Thbd APN 2 148406796 missense probably benign
IGL03111:Thbd APN 2 148406472 missense probably benign 0.00
F5770:Thbd UTSW 2 148407190 missense probably benign 0.05
PIT4283001:Thbd UTSW 2 148407083 missense probably benign 0.19
R0102:Thbd UTSW 2 148406983 missense probably damaging 1.00
R0102:Thbd UTSW 2 148406983 missense probably damaging 1.00
R1847:Thbd UTSW 2 148407684 nonsense probably null
R1957:Thbd UTSW 2 148406979 missense probably damaging 0.97
R2320:Thbd UTSW 2 148406646 missense probably damaging 1.00
R2900:Thbd UTSW 2 148406214 makesense probably null
R3623:Thbd UTSW 2 148406973 missense probably damaging 1.00
R4839:Thbd UTSW 2 148406671 missense probably damaging 1.00
R4936:Thbd UTSW 2 148407735 missense probably damaging 1.00
R5296:Thbd UTSW 2 148406983 missense probably damaging 1.00
R5521:Thbd UTSW 2 148407735 missense probably damaging 1.00
R5677:Thbd UTSW 2 148407366 missense probably damaging 1.00
R6581:Thbd UTSW 2 148406272 missense probably benign
R7139:Thbd UTSW 2 148406541 missense probably benign 0.37
R7246:Thbd UTSW 2 148406485 missense probably benign
R7655:Thbd UTSW 2 148407420 missense probably damaging 1.00
R7656:Thbd UTSW 2 148407420 missense probably damaging 1.00
R7752:Thbd UTSW 2 148406974 missense probably damaging 0.99
R7867:Thbd UTSW 2 148407744 missense probably damaging 1.00
R8398:Thbd UTSW 2 148406680 missense probably benign 0.00
R8429:Thbd UTSW 2 148407537 missense possibly damaging 0.70
R8986:Thbd UTSW 2 148406560 missense probably damaging 1.00
V7582:Thbd UTSW 2 148407190 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTGGGTCTCTGGAGCAAATC -3'
(R):5'- ACCAGTGAATGTCGAAACTTCC -3'

Sequencing Primer
(F):5'- GGAGCAAATCCCTCAGAACTTCTG -3'
(R):5'- GTGAATGTCGAAACTTCCCTGGC -3'
Posted On 2014-10-30