Mutagenetix > Incidental Mutations

Incidental Mutation 'R2362:Lrrcc1'

247165

Institutional Source

Beutler Lab

Gene Symbol

Lrrcc1

Ensembl Gene

ENSMUSG00000027550

Gene Name

leucine rich repeat and coiled-coil domain containing 1

Synonyms

MMRRC Submission

040343-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2362 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14533788-14572658 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 14563024 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 542 (E542G)

Ref Sequence

ENSEMBL: ENSMUSP00000129368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091325] [ENSMUST00000108370] [ENSMUST00000163660] [ENSMUST00000167858] [ENSMUST00000169079]

Predicted Effect

probably benign
Transcript: ENSMUST00000091325
AA Change: E947G

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000088875
Gene: ENSMUSG00000027550
AA Change: E947G

Domain	Start	End	E-Value	Type
Pfam:LRR_8	60	116	1.1e-9	PFAM
Pfam:LRR_4	82	126	4.8e-8	PFAM
Blast:LRR	130	151	1e-5	BLAST
coiled coil region	412	626	N/A	INTRINSIC
coiled coil region	675	718	N/A	INTRINSIC
coiled coil region	757	1010	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108370
AA Change: E963G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000104007
Gene: ENSMUSG00000027550
AA Change: E963G

Domain	Start	End	E-Value	Type
Pfam:LRR_8	60	116	1.1e-9	PFAM
Pfam:LRR_4	82	124	4.5e-8	PFAM
Blast:LRR	130	151	1e-5	BLAST
low complexity region	289	301	N/A	INTRINSIC
coiled coil region	428	642	N/A	INTRINSIC
coiled coil region	691	734	N/A	INTRINSIC
coiled coil region	773	953	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163660

SMART Domains

Protein: ENSMUSP00000128733
Gene: ENSMUSG00000027550

Domain	Start	End	E-Value	Type
Blast:LRR	8	29	7e-6	BLAST
SCOP:d1dcea3	9	71	9e-4	SMART
low complexity region	167	179	N/A	INTRINSIC
coiled coil region	306	520	N/A	INTRINSIC
coiled coil region	569	612	N/A	INTRINSIC
coiled coil region	651	716	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163943

Predicted Effect

probably damaging
Transcript: ENSMUST00000167858
AA Change: E542G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129368
Gene: ENSMUSG00000027550
AA Change: E542G

Domain	Start	End	E-Value	Type
coiled coil region	7	221	N/A	INTRINSIC
coiled coil region	270	313	N/A	INTRINSIC
low complexity region	450	472	N/A	INTRINSIC
SCOP:d1ek8a_	494	550	7e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169079
AA Change: E963G

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000126560
Gene: ENSMUSG00000027550
AA Change: E963G

Domain	Start	End	E-Value	Type
Pfam:LRR_4	60	102	4.3e-9	PFAM
internal_repeat_1	109	145	1.05e-6	PROSPERO
low complexity region	289	301	N/A	INTRINSIC
coiled coil region	428	642	N/A	INTRINSIC
coiled coil region	691	734	N/A	INTRINSIC
coiled coil region	773	1026	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169799

SMART Domains

Protein: ENSMUSP00000126592
Gene: ENSMUSG00000027550

Domain	Start	End	E-Value	Type
coiled coil region	1	131	N/A	INTRINSIC
coiled coil region	200	228	N/A	INTRINSIC

Meta Mutation Damage Score

0.0620

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

100% (35/35)

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630073D07Rik	A	T	6: 132,627,479	M1K	probably null	Het
Aadat	A	G	8: 60,532,298		probably benign	Het
Acsm5	T	C	7: 119,528,426		probably benign	Het
Avl9	A	T	6: 56,736,570	N271I	probably benign	Het
Ccdc30	T	A	4: 119,324,056	N636I	probably damaging	Het
Cdr2	T	G	7: 120,970,331	I62L	possibly damaging	Het
Clk3	T	C	9: 57,754,619	I382V	possibly damaging	Het
Ctsr	T	A	13: 61,162,796	E45V	probably damaging	Het
Cyp2b19	A	G	7: 26,764,377	Y318C	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dapk1	A	G	13: 60,730,931	N578S	probably damaging	Het
Dlg5	A	T	14: 24,158,687	M817K	probably benign	Het
Dtx4	A	G	19: 12,492,535	V76A	probably damaging	Het
Eps15	T	C	4: 109,361,230	V430A	probably benign	Het
Fam160b2	A	G	14: 70,586,365	Y568H	probably benign	Het
Fxyd5	T	C	7: 31,036,471	N104S	probably benign	Het
Gm5155	T	G	7: 17,902,473		noncoding transcript	Het
Ift122	A	G	6: 115,884,350	D193G	probably damaging	Het
Macc1	T	C	12: 119,447,658		probably benign	Het
Ndst3	T	A	3: 123,552,678	Y234F	possibly damaging	Het
Olfr1477	A	T	19: 13,502,508	H55L	probably damaging	Het
Pes1	T	C	11: 3,977,123	F429S	probably damaging	Het
Polr3e	C	G	7: 120,942,564	D623E	probably damaging	Het
Rapgef6	T	C	11: 54,694,272	Y1494H	probably damaging	Het
Rbm14	T	C	19: 4,801,707		probably benign	Het
Rnf103	A	G	6: 71,510,017	D544G	probably benign	Het
Slc10a7	A	G	8: 78,509,632	I20V	probably damaging	Het
Sort1	C	T	3: 108,346,665	T549I	possibly damaging	Het
Stambpl1	G	A	19: 34,236,354	V328I	probably benign	Het
Thbd	A	G	2: 148,406,364	L528P	probably damaging	Het
Wbp11	A	T	6: 136,824,332	M63K	probably damaging	Het
Wdr11	T	A	7: 129,634,836	I1178N	probably benign	Het

Other mutations in Lrrcc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00978:Lrrcc1	APN	3	14536128	missense	possibly damaging	0.91
IGL01325:Lrrcc1	APN	3	14536541	critical splice donor site	probably null
IGL01681:Lrrcc1	APN	3	14548226	missense	probably benign	0.35
IGL01767:Lrrcc1	APN	3	14547272	missense	probably damaging	0.97
IGL01868:Lrrcc1	APN	3	14554357	nonsense	probably null
IGL03123:Lrrcc1	APN	3	14536084	missense	probably damaging	0.97
PIT1430001:Lrrcc1	UTSW	3	14545596	missense	probably damaging	0.99
R0295:Lrrcc1	UTSW	3	14565849	missense	probably benign	0.05
R0427:Lrrcc1	UTSW	3	14558356	missense	probably damaging	1.00
R0433:Lrrcc1	UTSW	3	14559374	missense	probably damaging	1.00
R0534:Lrrcc1	UTSW	3	14557273	missense	probably damaging	1.00
R0631:Lrrcc1	UTSW	3	14540119	splice site	probably benign
R0635:Lrrcc1	UTSW	3	14559228	missense	probably benign	0.11
R1355:Lrrcc1	UTSW	3	14548114	missense	probably benign	0.07
R1370:Lrrcc1	UTSW	3	14548114	missense	probably benign	0.07
R1727:Lrrcc1	UTSW	3	14537363	missense	probably damaging	0.99
R1822:Lrrcc1	UTSW	3	14559225	unclassified	probably benign
R1946:Lrrcc1	UTSW	3	14550393	missense	probably benign	0.02
R2254:Lrrcc1	UTSW	3	14547255	missense	probably damaging	1.00
R2392:Lrrcc1	UTSW	3	14536520	missense	probably damaging	1.00
R4105:Lrrcc1	UTSW	3	14550328	missense	probably benign	0.21
R4464:Lrrcc1	UTSW	3	14557318	missense	probably damaging	1.00
R4484:Lrrcc1	UTSW	3	14551443	missense	probably damaging	1.00
R4543:Lrrcc1	UTSW	3	14539791	missense	probably damaging	0.98
R4718:Lrrcc1	UTSW	3	14536032	missense	probably damaging	1.00
R4734:Lrrcc1	UTSW	3	14562285	missense	probably damaging	1.00
R4799:Lrrcc1	UTSW	3	14536096	nonsense	probably null
R4841:Lrrcc1	UTSW	3	14562511	missense	probably benign	0.04
R4842:Lrrcc1	UTSW	3	14562511	missense	probably benign	0.04
R5900:Lrrcc1	UTSW	3	14562126	missense	possibly damaging	0.69
R6338:Lrrcc1	UTSW	3	14547316	missense	possibly damaging	0.48
R7001:Lrrcc1	UTSW	3	14540095	missense	probably damaging	0.99
R7036:Lrrcc1	UTSW	3	14563009	missense	possibly damaging	0.80
R7342:Lrrcc1	UTSW	3	14554371	missense	probably benign
R8038:Lrrcc1	UTSW	3	14565830	missense	possibly damaging	0.77
R8497:Lrrcc1	UTSW	3	14539984	missense	possibly damaging	0.80
R8509:Lrrcc1	UTSW	3	14536507	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGGTATTAATAACAGAGCCTGCAG -3'
(R):5'- CAGTTCCCTGGAGTTATTACCTG -3'

Sequencing Primer
(F):5'- GAGCCTGCAGACAGCTTCTTATTAG -3'
(R):5'- CCCTGGAGTTATTACCTGTTAATGAC -3'

Posted On

2014-10-30