Incidental Mutation 'R2362:Sort1'
ID 247167
Institutional Source Beutler Lab
Gene Symbol Sort1
Ensembl Gene ENSMUSG00000068747
Gene Name sortilin 1
Synonyms sortilin, 2900053A11Rik, Ntsr3, Ntr3, neurotensin receptor 3
MMRRC Submission 040343-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.775) question?
Stock # R2362 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 108284082-108361511 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 108346665 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 549 (T549I)
Ref Sequence ENSEMBL: ENSMUSP00000123564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102632] [ENSMUST00000135636]
AlphaFold Q6PHU5
Predicted Effect possibly damaging
Transcript: ENSMUST00000102632
AA Change: T549I

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099692
Gene: ENSMUSG00000068747
AA Change: T549I

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 59 79 N/A INTRINSIC
VPS10 131 743 N/A SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135636
AA Change: T549I

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123564
Gene: ENSMUSG00000068747
AA Change: T549I

DomainStartEndE-ValueType
VPS10 1 218 2.3e-5 SMART
transmembrane domain 262 284 N/A INTRINSIC
Meta Mutation Damage Score 0.0939 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the VPS10-related sortilin family of proteins. The encoded preproprotein is proteolytically processed by furin to generate the mature receptor. This receptor plays a role in the trafficking of different proteins to either the cell surface, or subcellular compartments such as lysosomes and endosomes. Expression levels of this gene may influence the risk of myocardial infarction in human patients. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhbit increased protection from age- and injury-related neuron lose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Aadat A G 8: 60,532,298 probably benign Het
Acsm5 T C 7: 119,528,426 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Cdr2 T G 7: 120,970,331 I62L possibly damaging Het
Clk3 T C 9: 57,754,619 I382V possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fam160b2 A G 14: 70,586,365 Y568H probably benign Het
Fxyd5 T C 7: 31,036,471 N104S probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Ift122 A G 6: 115,884,350 D193G probably damaging Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Olfr1477 A T 19: 13,502,508 H55L probably damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Polr3e C G 7: 120,942,564 D623E probably damaging Het
Rapgef6 T C 11: 54,694,272 Y1494H probably damaging Het
Rbm14 T C 19: 4,801,707 probably benign Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Slc10a7 A G 8: 78,509,632 I20V probably damaging Het
Stambpl1 G A 19: 34,236,354 V328I probably benign Het
Thbd A G 2: 148,406,364 L528P probably damaging Het
Wbp11 A T 6: 136,824,332 M63K probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Sort1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Sort1 APN 3 108356307 missense probably damaging 0.99
IGL01677:Sort1 APN 3 108344885 missense probably benign 0.05
IGL02532:Sort1 APN 3 108325720 missense probably benign 0.44
IGL03354:Sort1 APN 3 108348706 missense probably benign 0.00
R0266:Sort1 UTSW 3 108344931 missense probably benign 0.09
R0277:Sort1 UTSW 3 108324592 splice site probably benign
R0559:Sort1 UTSW 3 108356579 missense probably damaging 1.00
R0597:Sort1 UTSW 3 108338910 missense probably damaging 1.00
R0624:Sort1 UTSW 3 108348630 missense probably damaging 1.00
R1803:Sort1 UTSW 3 108325699 missense probably damaging 1.00
R1872:Sort1 UTSW 3 108340695 missense probably benign 0.01
R1986:Sort1 UTSW 3 108345727 missense possibly damaging 0.71
R2130:Sort1 UTSW 3 108351686 missense probably benign
R2131:Sort1 UTSW 3 108351686 missense probably benign
R2133:Sort1 UTSW 3 108351686 missense probably benign
R3436:Sort1 UTSW 3 108337807 missense probably damaging 1.00
R3548:Sort1 UTSW 3 108337909 missense possibly damaging 0.83
R3700:Sort1 UTSW 3 108356639 nonsense probably null
R4496:Sort1 UTSW 3 108310145 missense probably benign 0.17
R4616:Sort1 UTSW 3 108355541 missense possibly damaging 0.66
R4632:Sort1 UTSW 3 108346678 missense probably damaging 1.00
R4749:Sort1 UTSW 3 108356323 nonsense probably null
R4994:Sort1 UTSW 3 108328069 missense probably damaging 0.99
R5187:Sort1 UTSW 3 108324676 missense probably damaging 1.00
R5753:Sort1 UTSW 3 108345774 missense probably damaging 1.00
R6019:Sort1 UTSW 3 108357233 missense possibly damaging 0.77
R6262:Sort1 UTSW 3 108310211 missense probably damaging 1.00
R7369:Sort1 UTSW 3 108351680 missense probably damaging 1.00
R7484:Sort1 UTSW 3 108338825 missense probably damaging 1.00
R7512:Sort1 UTSW 3 108326007 splice site probably null
R8076:Sort1 UTSW 3 108338867 missense probably damaging 1.00
R8222:Sort1 UTSW 3 108334635 missense probably benign
R8871:Sort1 UTSW 3 108355571 critical splice donor site probably null
R8894:Sort1 UTSW 3 108338912 missense probably damaging 1.00
R9169:Sort1 UTSW 3 108340678 nonsense probably null
Z1177:Sort1 UTSW 3 108284380 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCATGCCTTCTATGAGTGAATCC -3'
(R):5'- GGAGACACTCACAATTCCGC -3'

Sequencing Primer
(F):5'- TTCTCATACCCTGCTAACTAGAGG -3'
(R):5'- CCGCTCAAGGATGTCTTTGAAATCG -3'
Posted On 2014-10-30