Mutagenetix > Incidental Mutations

Incidental Mutation 'R2362:Sort1'

247167

Institutional Source

Beutler Lab

Gene Symbol

Sort1

Ensembl Gene

ENSMUSG00000068747

Gene Name

sortilin 1

Synonyms

sortilin, 2900053A11Rik, Ntsr3, Ntr3, neurotensin receptor 3

MMRRC Submission

040343-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.775) question?

Stock #

R2362 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108284082-108361511 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 108346665 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 549 (T549I)

Ref Sequence

ENSEMBL: ENSMUSP00000123564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102632] [ENSMUST00000135636]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102632
AA Change: T549I

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099692
Gene: ENSMUSG00000068747
AA Change: T549I

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	33	47	N/A	INTRINSIC
low complexity region	59	79	N/A	INTRINSIC
VPS10	131	743	N/A	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135636
AA Change: T549I

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000123564
Gene: ENSMUSG00000068747
AA Change: T549I

Domain	Start	End	E-Value	Type
VPS10	1	218	2.3e-5	SMART
transmembrane domain	262	284	N/A	INTRINSIC

Meta Mutation Damage Score

0.0939

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the VPS10-related sortilin family of proteins. The encoded preproprotein is proteolytically processed by furin to generate the mature receptor. This receptor plays a role in the trafficking of different proteins to either the cell surface, or subcellular compartments such as lysosomes and endosomes. Expression levels of this gene may influence the risk of myocardial infarction in human patients. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhbit increased protection from age- and injury-related neuron lose. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630073D07Rik	A	T	6: 132,627,479	M1K	probably null	Het
Aadat	A	G	8: 60,532,298		probably benign	Het
Acsm5	T	C	7: 119,528,426		probably benign	Het
Avl9	A	T	6: 56,736,570	N271I	probably benign	Het
Ccdc30	T	A	4: 119,324,056	N636I	probably damaging	Het
Cdr2	T	G	7: 120,970,331	I62L	possibly damaging	Het
Clk3	T	C	9: 57,754,619	I382V	possibly damaging	Het
Ctsr	T	A	13: 61,162,796	E45V	probably damaging	Het
Cyp2b19	A	G	7: 26,764,377	Y318C	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dapk1	A	G	13: 60,730,931	N578S	probably damaging	Het
Dlg5	A	T	14: 24,158,687	M817K	probably benign	Het
Dtx4	A	G	19: 12,492,535	V76A	probably damaging	Het
Eps15	T	C	4: 109,361,230	V430A	probably benign	Het
Fam160b2	A	G	14: 70,586,365	Y568H	probably benign	Het
Fxyd5	T	C	7: 31,036,471	N104S	probably benign	Het
Gm5155	T	G	7: 17,902,473		noncoding transcript	Het
Ift122	A	G	6: 115,884,350	D193G	probably damaging	Het
Lrrcc1	A	G	3: 14,563,024	E542G	probably damaging	Het
Macc1	T	C	12: 119,447,658		probably benign	Het
Ndst3	T	A	3: 123,552,678	Y234F	possibly damaging	Het
Olfr1477	A	T	19: 13,502,508	H55L	probably damaging	Het
Pes1	T	C	11: 3,977,123	F429S	probably damaging	Het
Polr3e	C	G	7: 120,942,564	D623E	probably damaging	Het
Rapgef6	T	C	11: 54,694,272	Y1494H	probably damaging	Het
Rbm14	T	C	19: 4,801,707		probably benign	Het
Rnf103	A	G	6: 71,510,017	D544G	probably benign	Het
Slc10a7	A	G	8: 78,509,632	I20V	probably damaging	Het
Stambpl1	G	A	19: 34,236,354	V328I	probably benign	Het
Thbd	A	G	2: 148,406,364	L528P	probably damaging	Het
Wbp11	A	T	6: 136,824,332	M63K	probably damaging	Het
Wdr11	T	A	7: 129,634,836	I1178N	probably benign	Het

Other mutations in Sort1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Sort1	APN	3	108356307	missense	probably damaging	0.99
IGL01677:Sort1	APN	3	108344885	missense	probably benign	0.05
IGL02532:Sort1	APN	3	108325720	missense	probably benign	0.44
IGL03354:Sort1	APN	3	108348706	missense	probably benign	0.00
R0266:Sort1	UTSW	3	108344931	missense	probably benign	0.09
R0277:Sort1	UTSW	3	108324592	splice site	probably benign
R0559:Sort1	UTSW	3	108356579	missense	probably damaging	1.00
R0597:Sort1	UTSW	3	108338910	missense	probably damaging	1.00
R0624:Sort1	UTSW	3	108348630	missense	probably damaging	1.00
R1803:Sort1	UTSW	3	108325699	missense	probably damaging	1.00
R1872:Sort1	UTSW	3	108340695	missense	probably benign	0.01
R1986:Sort1	UTSW	3	108345727	missense	possibly damaging	0.71
R2130:Sort1	UTSW	3	108351686	missense	probably benign
R2131:Sort1	UTSW	3	108351686	missense	probably benign
R2133:Sort1	UTSW	3	108351686	missense	probably benign
R3436:Sort1	UTSW	3	108337807	missense	probably damaging	1.00
R3548:Sort1	UTSW	3	108337909	missense	possibly damaging	0.83
R3700:Sort1	UTSW	3	108356639	nonsense	probably null
R4496:Sort1	UTSW	3	108310145	missense	probably benign	0.17
R4616:Sort1	UTSW	3	108355541	missense	possibly damaging	0.66
R4632:Sort1	UTSW	3	108346678	missense	probably damaging	1.00
R4749:Sort1	UTSW	3	108356323	nonsense	probably null
R4994:Sort1	UTSW	3	108328069	missense	probably damaging	0.99
R5187:Sort1	UTSW	3	108324676	missense	probably damaging	1.00
R5753:Sort1	UTSW	3	108345774	missense	probably damaging	1.00
R6019:Sort1	UTSW	3	108357233	missense	possibly damaging	0.77
R6262:Sort1	UTSW	3	108310211	missense	probably damaging	1.00
R7369:Sort1	UTSW	3	108351680	missense	probably damaging	1.00
R7484:Sort1	UTSW	3	108338825	missense	probably damaging	1.00
R7512:Sort1	UTSW	3	108326007	splice site	probably null
R8076:Sort1	UTSW	3	108338867	missense	probably damaging	1.00
R8222:Sort1	UTSW	3	108334635	missense	probably benign
Z1177:Sort1	UTSW	3	108284380	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCATGCCTTCTATGAGTGAATCC -3'
(R):5'- GGAGACACTCACAATTCCGC -3'

Sequencing Primer
(F):5'- TTCTCATACCCTGCTAACTAGAGG -3'
(R):5'- CCGCTCAAGGATGTCTTTGAAATCG -3'

Posted On

2014-10-30