Incidental Mutation 'R2362:Dab1'
ID247169
Institutional Source Beutler Lab
Gene Symbol Dab1
Ensembl Gene ENSMUSG00000028519
Gene Namedisabled 1
SynonymsC630028C02Rik
MMRRC Submission 040343-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock #R2362 (G1)
Quality Score209
Status Validated
Chromosome4
Chromosomal Location103619359-104744844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104731751 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 524 (A524V)
Ref Sequence ENSEMBL: ENSMUSP00000102443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106830] [ENSMUST00000146078]
Predicted Effect probably benign
Transcript: ENSMUST00000106830
AA Change: A524V

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102443
Gene: ENSMUSG00000028519
AA Change: A524V

DomainStartEndE-ValueType
PTB 37 171 3.51e-36 SMART
low complexity region 254 267 N/A INTRINSIC
low complexity region 470 487 N/A INTRINSIC
low complexity region 490 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146078
SMART Domains Protein: ENSMUSP00000125033
Gene: ENSMUSG00000028519

DomainStartEndE-ValueType
PTB 37 171 3.51e-36 SMART
low complexity region 235 242 N/A INTRINSIC
Meta Mutation Damage Score 0.2232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The laminar organization of multiple neuronal types in the cerebral cortex is required for normal cognitive function. In mice, the disabled-1 gene plays a central role in brain development, directing the migration of cortical neurons past previously formed neurons to reach their proper layer. This gene is similar to disabled-1, and the protein encoded by this gene is thought to be a signal transducer that interacts with protein kinase pathways to regulate neuronal positioning in the developing brain. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous null display unstable gait and whole-body tremor with a hypoplastic cerebellum devoid of folia, a probable consequence of defective neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Aadat A G 8: 60,532,298 probably benign Het
Acsm5 T C 7: 119,528,426 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Cdr2 T G 7: 120,970,331 I62L possibly damaging Het
Clk3 T C 9: 57,754,619 I382V possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fam160b2 A G 14: 70,586,365 Y568H probably benign Het
Fxyd5 T C 7: 31,036,471 N104S probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Ift122 A G 6: 115,884,350 D193G probably damaging Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Olfr1477 A T 19: 13,502,508 H55L probably damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Polr3e C G 7: 120,942,564 D623E probably damaging Het
Rapgef6 T C 11: 54,694,272 Y1494H probably damaging Het
Rbm14 T C 19: 4,801,707 probably benign Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Slc10a7 A G 8: 78,509,632 I20V probably damaging Het
Sort1 C T 3: 108,346,665 T549I possibly damaging Het
Stambpl1 G A 19: 34,236,354 V328I probably benign Het
Thbd A G 2: 148,406,364 L528P probably damaging Het
Wbp11 A T 6: 136,824,332 M63K probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Dab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dab1 APN 4 104678810 missense probably damaging 1.00
IGL00087:Dab1 APN 4 104678753 missense possibly damaging 0.90
IGL00328:Dab1 APN 4 104688438 missense possibly damaging 0.55
IGL00756:Dab1 APN 4 104727878 missense probably benign
IGL02074:Dab1 APN 4 104727854 missense possibly damaging 0.90
IGL02286:Dab1 APN 4 104680070 missense probably damaging 1.00
IGL02986:Dab1 APN 4 104479221 missense probably benign 0.00
IGL03008:Dab1 APN 4 104727580 missense probably damaging 0.99
IGL03133:Dab1 APN 4 104727580 missense probably benign 0.41
IGL03375:Dab1 APN 4 104681601 missense possibly damaging 0.70
LCD18:Dab1 UTSW 4 104046572 intron probably benign
R0027:Dab1 UTSW 4 104704199 intron probably benign
R0466:Dab1 UTSW 4 104720550 missense probably benign 0.15
R0838:Dab1 UTSW 4 104731751 missense probably benign 0.29
R0840:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1086:Dab1 UTSW 4 104328572 intron probably benign
R1598:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1640:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1699:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1749:Dab1 UTSW 4 104328298 intron probably benign
R1770:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1846:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1847:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1848:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1885:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1986:Dab1 UTSW 4 104613215 missense probably damaging 0.97
R1990:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2006:Dab1 UTSW 4 104605325 missense probably damaging 1.00
R2030:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2032:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2034:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2061:Dab1 UTSW 4 104678741 missense probably damaging 1.00
R2088:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2089:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2091:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2091:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2092:Dab1 UTSW 4 104678777 missense probably damaging 1.00
R2193:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2194:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2361:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2391:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2424:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2865:Dab1 UTSW 4 104680146 missense probably benign
R3118:Dab1 UTSW 4 104680069 critical splice acceptor site probably null
R3716:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3718:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3740:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3742:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3965:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4057:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4393:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4396:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4418:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4607:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4608:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4648:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4693:Dab1 UTSW 4 104679553 missense probably damaging 1.00
R4701:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4730:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4760:Dab1 UTSW 4 104732145 missense probably damaging 1.00
R4927:Dab1 UTSW 4 104704252 missense probably benign
R5173:Dab1 UTSW 4 104688448 splice site probably null
R5503:Dab1 UTSW 4 104512264 missense probably benign 0.01
R6199:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6200:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6207:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6224:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6227:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6228:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6229:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6246:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6247:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6248:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6249:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6250:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6258:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6259:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6260:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6505:Dab1 UTSW 4 104512264 missense probably benign 0.01
R6817:Dab1 UTSW 4 104679546 missense probably damaging 1.00
R7305:Dab1 UTSW 4 104713790 missense
R7709:Dab1 UTSW 4 104720559 nonsense probably null
Z1088:Dab1 UTSW 4 104479232 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGGATATAAATGGCTGTGGC -3'
(R):5'- TACAGGAGGCTGAAACTTCCCC -3'

Sequencing Primer
(F):5'- GGATATAAATGGCTGTGGCTTATATG -3'
(R):5'- TGAAACTTCCCCCAGAGGATG -3'
Posted On2014-10-30