Mutagenetix > Incidental Mutations

Incidental Mutation 'R2362:Dab1'

247169

Institutional Source

Beutler Lab

Gene Symbol

Dab1

Ensembl Gene

ENSMUSG00000028519

Gene Name

disabled 1

Synonyms

C630028C02Rik

MMRRC Submission

040343-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.797) question?

Stock #

R2362 (G1)

Quality Score

209

Status

Validated

Chromosome

Chromosomal Location

103619359-104744844 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 104731751 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 524 (A524V)

Ref Sequence

ENSEMBL: ENSMUSP00000102443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106830] [ENSMUST00000146078]

Predicted Effect

probably benign
Transcript: ENSMUST00000106830
AA Change: A524V

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000102443
Gene: ENSMUSG00000028519
AA Change: A524V

Domain	Start	End	E-Value	Type
PTB	37	171	3.51e-36	SMART
low complexity region	254	267	N/A	INTRINSIC
low complexity region	470	487	N/A	INTRINSIC
low complexity region	490	501	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146078

SMART Domains

Protein: ENSMUSP00000125033
Gene: ENSMUSG00000028519

Domain	Start	End	E-Value	Type
PTB	37	171	3.51e-36	SMART
low complexity region	235	242	N/A	INTRINSIC

Meta Mutation Damage Score

0.2232

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The laminar organization of multiple neuronal types in the cerebral cortex is required for normal cognitive function. In mice, the disabled-1 gene plays a central role in brain development, directing the migration of cortical neurons past previously formed neurons to reach their proper layer. This gene is similar to disabled-1, and the protein encoded by this gene is thought to be a signal transducer that interacts with protein kinase pathways to regulate neuronal positioning in the developing brain. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous null display unstable gait and whole-body tremor with a hypoplastic cerebellum devoid of folia, a probable consequence of defective neuronal migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630073D07Rik	A	T	6: 132,627,479	M1K	probably null	Het
Aadat	A	G	8: 60,532,298		probably benign	Het
Acsm5	T	C	7: 119,528,426		probably benign	Het
Avl9	A	T	6: 56,736,570	N271I	probably benign	Het
Ccdc30	T	A	4: 119,324,056	N636I	probably damaging	Het
Cdr2	T	G	7: 120,970,331	I62L	possibly damaging	Het
Clk3	T	C	9: 57,754,619	I382V	possibly damaging	Het
Ctsr	T	A	13: 61,162,796	E45V	probably damaging	Het
Cyp2b19	A	G	7: 26,764,377	Y318C	probably damaging	Het
Dapk1	A	G	13: 60,730,931	N578S	probably damaging	Het
Dlg5	A	T	14: 24,158,687	M817K	probably benign	Het
Dtx4	A	G	19: 12,492,535	V76A	probably damaging	Het
Eps15	T	C	4: 109,361,230	V430A	probably benign	Het
Fam160b2	A	G	14: 70,586,365	Y568H	probably benign	Het
Fxyd5	T	C	7: 31,036,471	N104S	probably benign	Het
Gm5155	T	G	7: 17,902,473		noncoding transcript	Het
Ift122	A	G	6: 115,884,350	D193G	probably damaging	Het
Lrrcc1	A	G	3: 14,563,024	E542G	probably damaging	Het
Macc1	T	C	12: 119,447,658		probably benign	Het
Ndst3	T	A	3: 123,552,678	Y234F	possibly damaging	Het
Olfr1477	A	T	19: 13,502,508	H55L	probably damaging	Het
Pes1	T	C	11: 3,977,123	F429S	probably damaging	Het
Polr3e	C	G	7: 120,942,564	D623E	probably damaging	Het
Rapgef6	T	C	11: 54,694,272	Y1494H	probably damaging	Het
Rbm14	T	C	19: 4,801,707		probably benign	Het
Rnf103	A	G	6: 71,510,017	D544G	probably benign	Het
Slc10a7	A	G	8: 78,509,632	I20V	probably damaging	Het
Sort1	C	T	3: 108,346,665	T549I	possibly damaging	Het
Stambpl1	G	A	19: 34,236,354	V328I	probably benign	Het
Thbd	A	G	2: 148,406,364	L528P	probably damaging	Het
Wbp11	A	T	6: 136,824,332	M63K	probably damaging	Het
Wdr11	T	A	7: 129,634,836	I1178N	probably benign	Het

Other mutations in Dab1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Dab1	APN	4	104678810	missense	probably damaging	1.00
IGL00087:Dab1	APN	4	104678753	missense	possibly damaging	0.90
IGL00328:Dab1	APN	4	104688438	missense	possibly damaging	0.55
IGL00756:Dab1	APN	4	104727878	missense	probably benign
IGL02074:Dab1	APN	4	104727854	missense	possibly damaging	0.90
IGL02286:Dab1	APN	4	104680070	missense	probably damaging	1.00
IGL02986:Dab1	APN	4	104479221	missense	probably benign	0.00
IGL03008:Dab1	APN	4	104727580	missense	probably damaging	0.99
IGL03133:Dab1	APN	4	104727580	missense	probably benign	0.41
IGL03375:Dab1	APN	4	104681601	missense	possibly damaging	0.70
LCD18:Dab1	UTSW	4	104046572	intron	probably benign
R0027:Dab1	UTSW	4	104704199	intron	probably benign
R0466:Dab1	UTSW	4	104720550	missense	probably benign	0.15
R0838:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R0840:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1086:Dab1	UTSW	4	104328572	intron	probably benign
R1598:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1640:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1699:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1749:Dab1	UTSW	4	104328298	intron	probably benign
R1770:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1846:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1847:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1848:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1885:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1986:Dab1	UTSW	4	104613215	missense	probably damaging	0.97
R1990:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2006:Dab1	UTSW	4	104605325	missense	probably damaging	1.00
R2030:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2032:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2034:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2061:Dab1	UTSW	4	104678741	missense	probably damaging	1.00
R2088:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2089:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2091:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2091:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2092:Dab1	UTSW	4	104678777	missense	probably damaging	1.00
R2193:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2194:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2361:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2391:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2424:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2865:Dab1	UTSW	4	104680146	missense	probably benign
R3118:Dab1	UTSW	4	104680069	critical splice acceptor site	probably null
R3716:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R3718:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R3740:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R3742:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R3965:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4057:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4393:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4396:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4418:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4607:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4608:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4648:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4693:Dab1	UTSW	4	104679553	missense	probably damaging	1.00
R4701:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4730:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4760:Dab1	UTSW	4	104732145	missense	probably damaging	1.00
R4927:Dab1	UTSW	4	104704252	missense	probably benign
R5173:Dab1	UTSW	4	104688448	splice site	probably null
R5503:Dab1	UTSW	4	104512264	missense	probably benign	0.01
R6199:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6200:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6207:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6224:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6227:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6228:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6229:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6246:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6247:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6248:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6249:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6250:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6258:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6259:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6260:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6505:Dab1	UTSW	4	104512264	missense	probably benign	0.01
R6817:Dab1	UTSW	4	104679546	missense	probably damaging	1.00
R7305:Dab1	UTSW	4	104713790	missense
R7709:Dab1	UTSW	4	104720559	nonsense	probably null
Z1088:Dab1	UTSW	4	104479232	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATGGGATATAAATGGCTGTGGC -3'
(R):5'- TACAGGAGGCTGAAACTTCCCC -3'

Sequencing Primer
(F):5'- GGATATAAATGGCTGTGGCTTATATG -3'
(R):5'- TGAAACTTCCCCCAGAGGATG -3'

Posted On

2014-10-30