Mutagenetix > Incidental Mutations

Incidental Mutation 'R2362:Rnf103'

247174

Institutional Source

Beutler Lab

Gene Symbol

Rnf103

Ensembl Gene

ENSMUSG00000052656

Gene Name

ring finger protein 103

Synonyms

Zfp103, kf-1

MMRRC Submission

040343-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.175) question?

Stock #

R2362 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71493894-71510881 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 71510017 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 544 (D544G)

Ref Sequence

ENSEMBL: ENSMUSP00000109817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064637] [ENSMUST00000114178] [ENSMUST00000114179]

AlphaFold

Q9R1W3

Predicted Effect

probably benign
Transcript: ENSMUST00000064637
AA Change: D544G

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000066324
Gene: ENSMUSG00000052656
AA Change: D544G

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	326	348	N/A	INTRINSIC
transmembrane domain	353	375	N/A	INTRINSIC
transmembrane domain	412	431	N/A	INTRINSIC
low complexity region	523	531	N/A	INTRINSIC
RING	619	660	5.07e-6	SMART
low complexity region	665	676	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114178

SMART Domains

Protein: ENSMUSP00000109816
Gene: ENSMUSG00000052656

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
low complexity region	162	173	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114179
AA Change: D544G

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000109817
Gene: ENSMUSG00000052656
AA Change: D544G

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	326	348	N/A	INTRINSIC
transmembrane domain	353	375	N/A	INTRINSIC
transmembrane domain	412	431	N/A	INTRINSIC
low complexity region	523	531	N/A	INTRINSIC
RING	619	660	5.07e-6	SMART
low complexity region	665	676	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150069

Meta Mutation Damage Score

0.0783

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: This gene encodes a member of the RING finger family of E3 ubiquitin-protein ligases. These proteins catalyze the transfer of the ubiquitin protein from a ubiquitin E2 enzyme to a protein substrate. Homozygous knockout mice for this gene exhibit enhanced anxiety-like behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display significantly increased anxiety-like behavior under stressful conditions as well as increased prepulse inhibition and a reduced startle amplitude with no detectable changes in exploratory locomotion or behavioral despair. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630073D07Rik	A	T	6: 132,627,479	M1K	probably null	Het
Aadat	A	G	8: 60,532,298		probably benign	Het
Acsm5	T	C	7: 119,528,426		probably benign	Het
Avl9	A	T	6: 56,736,570	N271I	probably benign	Het
Ccdc30	T	A	4: 119,324,056	N636I	probably damaging	Het
Cdr2	T	G	7: 120,970,331	I62L	possibly damaging	Het
Clk3	T	C	9: 57,754,619	I382V	possibly damaging	Het
Ctsr	T	A	13: 61,162,796	E45V	probably damaging	Het
Cyp2b19	A	G	7: 26,764,377	Y318C	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dapk1	A	G	13: 60,730,931	N578S	probably damaging	Het
Dlg5	A	T	14: 24,158,687	M817K	probably benign	Het
Dtx4	A	G	19: 12,492,535	V76A	probably damaging	Het
Eps15	T	C	4: 109,361,230	V430A	probably benign	Het
Fam160b2	A	G	14: 70,586,365	Y568H	probably benign	Het
Fxyd5	T	C	7: 31,036,471	N104S	probably benign	Het
Gm5155	T	G	7: 17,902,473		noncoding transcript	Het
Ift122	A	G	6: 115,884,350	D193G	probably damaging	Het
Lrrcc1	A	G	3: 14,563,024	E542G	probably damaging	Het
Macc1	T	C	12: 119,447,658		probably benign	Het
Ndst3	T	A	3: 123,552,678	Y234F	possibly damaging	Het
Olfr1477	A	T	19: 13,502,508	H55L	probably damaging	Het
Pes1	T	C	11: 3,977,123	F429S	probably damaging	Het
Polr3e	C	G	7: 120,942,564	D623E	probably damaging	Het
Rapgef6	T	C	11: 54,694,272	Y1494H	probably damaging	Het
Rbm14	T	C	19: 4,801,707		probably benign	Het
Slc10a7	A	G	8: 78,509,632	I20V	probably damaging	Het
Sort1	C	T	3: 108,346,665	T549I	possibly damaging	Het
Stambpl1	G	A	19: 34,236,354	V328I	probably benign	Het
Thbd	A	G	2: 148,406,364	L528P	probably damaging	Het
Wbp11	A	T	6: 136,824,332	M63K	probably damaging	Het
Wdr11	T	A	7: 129,634,836	I1178N	probably benign	Het

Other mutations in Rnf103

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00510:Rnf103	APN	6	71509749	missense	probably damaging	0.99
IGL00589:Rnf103	APN	6	71509083	missense	probably benign	0.00
IGL01601:Rnf103	APN	6	71509183	missense	probably damaging	1.00
IGL01732:Rnf103	APN	6	71510382	missense	probably damaging	0.97
IGL02130:Rnf103	APN	6	71509564	missense	probably damaging	1.00
IGL02227:Rnf103	APN	6	71510188	missense	probably benign	0.01
IGL02386:Rnf103	APN	6	71509218	missense	probably benign
IGL02532:Rnf103	APN	6	71509825	missense	probably benign	0.19
IGL02532:Rnf103	APN	6	71509652	missense	probably damaging	0.96
IGL02747:Rnf103	APN	6	71509177	missense	probably damaging	0.97
IGL02839:Rnf103	APN	6	71509705	missense	probably benign	0.41
IGL03247:Rnf103	APN	6	71510305	missense	possibly damaging	0.78
R0140:Rnf103	UTSW	6	71509331	missense	possibly damaging	0.76
R0308:Rnf103	UTSW	6	71509702	missense	probably damaging	1.00
R0764:Rnf103	UTSW	6	71509582	missense	probably damaging	0.96
R1428:Rnf103	UTSW	6	71508999	missense	probably damaging	1.00
R3847:Rnf103	UTSW	6	71508875	missense	probably damaging	1.00
R3849:Rnf103	UTSW	6	71508875	missense	probably damaging	1.00
R3919:Rnf103	UTSW	6	71510347	missense	probably benign	0.08
R4914:Rnf103	UTSW	6	71510264	missense	possibly damaging	0.71
R5620:Rnf103	UTSW	6	71510008	missense	probably benign	0.04
R5634:Rnf103	UTSW	6	71509617	missense	probably benign	0.01
R5682:Rnf103	UTSW	6	71508724	intron	probably benign
R5791:Rnf103	UTSW	6	71508925	missense	probably damaging	0.99
R5994:Rnf103	UTSW	6	71496910	missense	probably damaging	0.99
R6347:Rnf103	UTSW	6	71505824	missense	possibly damaging	0.89
R6551:Rnf103	UTSW	6	71510365	missense	probably damaging	1.00
R7739:Rnf103	UTSW	6	71509479	missense	possibly damaging	0.77
R7819:Rnf103	UTSW	6	71508930	missense	probably benign	0.00
R7903:Rnf103	UTSW	6	71509154	missense	probably damaging	1.00
R8750:Rnf103	UTSW	6	71509618	missense	probably benign	0.11
R8784:Rnf103	UTSW	6	71509998	missense	probably benign	0.03
R8974:Rnf103	UTSW	6	71509108	missense	probably damaging	0.98
R9154:Rnf103	UTSW	6	71510115	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CTGACTTATTCTTGGAACGGTTAGC -3'
(R):5'- TTCAGTACAGTGCAGCGTACC -3'

Sequencing Primer
(F):5'- GGAACGGTTAGCTTTCCCTGAC -3'
(R):5'- AGGCCAAGTTAACCAGTCCGG -3'

Posted On

2014-10-30