Incidental Mutation 'R2362:Ift122'
ID 247176
Institutional Source Beutler Lab
Gene Symbol Ift122
Ensembl Gene ENSMUSG00000030323
Gene Name intraflagellar transport 122
Synonyms C86139, sopb, Wdr10
MMRRC Submission 040343-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2362 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 115853470-115926699 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115884350 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 193 (D193G)
Ref Sequence ENSEMBL: ENSMUSP00000045468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000141305]
AlphaFold Q6NWV3
Predicted Effect probably damaging
Transcript: ENSMUST00000038234
AA Change: D193G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323
AA Change: D193G

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112923
AA Change: D252G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323
AA Change: D252G

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
Blast:WD40 163 267 3e-46 BLAST
WD40 269 308 1.91e1 SMART
WD40 310 349 3.45e-3 SMART
WD40 507 542 1.43e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112925
AA Change: D193G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323
AA Change: D193G

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138113
Predicted Effect probably benign
Transcript: ENSMUST00000141305
SMART Domains Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
low complexity region 124 134 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152092
Meta Mutation Damage Score 0.5155 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Mutations in this gene cause cranioectodermal dysplasia-1. A related pseudogene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null mutation display embryonic lethality during organogenesis with exencephaly, a ventralized caudal neural tube, preaxial polydactyly, abnormal cilia, and left-right patterning defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Aadat A G 8: 60,532,298 probably benign Het
Acsm5 T C 7: 119,528,426 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Cdr2 T G 7: 120,970,331 I62L possibly damaging Het
Clk3 T C 9: 57,754,619 I382V possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fam160b2 A G 14: 70,586,365 Y568H probably benign Het
Fxyd5 T C 7: 31,036,471 N104S probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Olfr1477 A T 19: 13,502,508 H55L probably damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Polr3e C G 7: 120,942,564 D623E probably damaging Het
Rapgef6 T C 11: 54,694,272 Y1494H probably damaging Het
Rbm14 T C 19: 4,801,707 probably benign Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Slc10a7 A G 8: 78,509,632 I20V probably damaging Het
Sort1 C T 3: 108,346,665 T549I possibly damaging Het
Stambpl1 G A 19: 34,236,354 V328I probably benign Het
Thbd A G 2: 148,406,364 L528P probably damaging Het
Wbp11 A T 6: 136,824,332 M63K probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Ift122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ift122 APN 6 115917057 missense probably benign 0.10
IGL00783:Ift122 APN 6 115905902 missense probably benign
IGL00784:Ift122 APN 6 115905902 missense probably benign
IGL00799:Ift122 APN 6 115877536 missense probably damaging 1.00
IGL00908:Ift122 APN 6 115913909 missense probably benign 0.00
IGL01012:Ift122 APN 6 115899491 missense probably damaging 0.99
IGL01444:Ift122 APN 6 115884379 missense probably benign 0.08
IGL01451:Ift122 APN 6 115912604 critical splice donor site probably null
IGL01940:Ift122 APN 6 115887371 splice site probably benign
IGL02089:Ift122 APN 6 115925437 missense probably benign 0.00
IGL02331:Ift122 APN 6 115887324 missense probably damaging 1.00
IGL02929:Ift122 APN 6 115902877 missense probably damaging 1.00
IGL03169:Ift122 APN 6 115905961 splice site probably benign
PIT1430001:Ift122 UTSW 6 115925744 splice site probably benign
R0158:Ift122 UTSW 6 115924484 splice site probably benign
R0496:Ift122 UTSW 6 115905902 missense probably benign
R1065:Ift122 UTSW 6 115875325 splice site probably null
R1670:Ift122 UTSW 6 115923883 missense probably benign 0.05
R1861:Ift122 UTSW 6 115891928 missense probably damaging 1.00
R1889:Ift122 UTSW 6 115894421 critical splice donor site probably null
R1990:Ift122 UTSW 6 115924367 missense probably damaging 1.00
R2385:Ift122 UTSW 6 115912522 missense probably benign 0.21
R3734:Ift122 UTSW 6 115925501 splice site probably benign
R3800:Ift122 UTSW 6 115925906 missense probably benign 0.03
R3981:Ift122 UTSW 6 115913921 missense probably benign 0.02
R4289:Ift122 UTSW 6 115923891 missense probably damaging 1.00
R4545:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4546:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4641:Ift122 UTSW 6 115888765 nonsense probably null
R4815:Ift122 UTSW 6 115881556 missense possibly damaging 0.95
R4854:Ift122 UTSW 6 115862746 missense possibly damaging 0.61
R4928:Ift122 UTSW 6 115915858 utr 3 prime probably benign
R5021:Ift122 UTSW 6 115864372 missense probably benign 0.41
R5121:Ift122 UTSW 6 115912534 missense probably benign 0.04
R5200:Ift122 UTSW 6 115920379 missense probably damaging 0.99
R5549:Ift122 UTSW 6 115892022 missense probably damaging 1.00
R6111:Ift122 UTSW 6 115875286 missense probably damaging 1.00
R6141:Ift122 UTSW 6 115916011 missense probably damaging 0.99
R6766:Ift122 UTSW 6 115926243 missense probably benign 0.15
R7379:Ift122 UTSW 6 115926302 missense probably benign
R7402:Ift122 UTSW 6 115894322 missense probably benign 0.00
R7436:Ift122 UTSW 6 115926302 missense probably benign
R7437:Ift122 UTSW 6 115926302 missense probably benign
R7438:Ift122 UTSW 6 115926302 missense probably benign
R7517:Ift122 UTSW 6 115890582 missense probably benign 0.37
R7978:Ift122 UTSW 6 115920352 missense probably benign 0.37
R8492:Ift122 UTSW 6 115887005 missense probably benign 0.02
R8493:Ift122 UTSW 6 115910331 missense probably benign 0.01
R8669:Ift122 UTSW 6 115923291 missense probably damaging 0.98
R8867:Ift122 UTSW 6 115880671 missense probably damaging 1.00
R8887:Ift122 UTSW 6 115891919 missense probably benign 0.00
R8947:Ift122 UTSW 6 115924407 missense probably benign
R8978:Ift122 UTSW 6 115925808 missense possibly damaging 0.78
R9149:Ift122 UTSW 6 115890531 missense probably damaging 1.00
R9571:Ift122 UTSW 6 115880667 missense possibly damaging 0.50
R9573:Ift122 UTSW 6 115880685 missense probably benign
R9677:Ift122 UTSW 6 115920396 missense probably benign 0.16
Z1176:Ift122 UTSW 6 115915994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATAGCAGATCCCAGGAG -3'
(R):5'- AAAGTCAAGCTCACTATGCAGC -3'

Sequencing Primer
(F):5'- AGGGCCAAACCTGTCTTTG -3'
(R):5'- GCAGCCACTAACAATGATTATGTG -3'
Posted On 2014-10-30