Mutagenetix > Incidental Mutation

Incidental Mutation 'R2362:Ift122'

247176

Institutional Source

Beutler Lab

Gene Symbol

Ift122

Ensembl Gene

ENSMUSG00000030323

Gene Name

intraflagellar transport 122

Synonyms

C86139, sopb, Wdr10

MMRRC Submission

040343-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2362 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115853470-115926699 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115884350 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 193 (D193G)

Ref Sequence

ENSEMBL: ENSMUSP00000045468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000141305]

AlphaFold

Q6NWV3

Predicted Effect

probably damaging
Transcript: ENSMUST00000038234
AA Change: D193G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323
AA Change: D193G

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
WD40	162	208	2.29e1	SMART
WD40	210	249	1.91e1	SMART
WD40	251	290	3.45e-3	SMART
WD40	448	483	1.43e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112923
AA Change: D252G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323
AA Change: D252G

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
Blast:WD40	163	267	3e-46	BLAST
WD40	269	308	1.91e1	SMART
WD40	310	349	3.45e-3	SMART
WD40	507	542	1.43e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112925
AA Change: D193G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323
AA Change: D193G

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
WD40	162	208	2.29e1	SMART
WD40	210	249	1.91e1	SMART
WD40	251	290	3.45e-3	SMART
WD40	448	483	1.43e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138113

Predicted Effect

probably benign
Transcript: ENSMUST00000141305

SMART Domains

Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
low complexity region	124	134	N/A	INTRINSIC
low complexity region	162	176	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149083

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152092

Meta Mutation Damage Score

0.5155

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Mutations in this gene cause cranioectodermal dysplasia-1. A related pseudogene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null mutation display embryonic lethality during organogenesis with exencephaly, a ventralized caudal neural tube, preaxial polydactyly, abnormal cilia, and left-right patterning defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630073D07Rik	A	T	6: 132,627,479	M1K	probably null	Het
Aadat	A	G	8: 60,532,298		probably benign	Het
Acsm5	T	C	7: 119,528,426		probably benign	Het
Avl9	A	T	6: 56,736,570	N271I	probably benign	Het
Ccdc30	T	A	4: 119,324,056	N636I	probably damaging	Het
Cdr2	T	G	7: 120,970,331	I62L	possibly damaging	Het
Clk3	T	C	9: 57,754,619	I382V	possibly damaging	Het
Ctsr	T	A	13: 61,162,796	E45V	probably damaging	Het
Cyp2b19	A	G	7: 26,764,377	Y318C	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dapk1	A	G	13: 60,730,931	N578S	probably damaging	Het
Dlg5	A	T	14: 24,158,687	M817K	probably benign	Het
Dtx4	A	G	19: 12,492,535	V76A	probably damaging	Het
Eps15	T	C	4: 109,361,230	V430A	probably benign	Het
Fam160b2	A	G	14: 70,586,365	Y568H	probably benign	Het
Fxyd5	T	C	7: 31,036,471	N104S	probably benign	Het
Gm5155	T	G	7: 17,902,473		noncoding transcript	Het
Lrrcc1	A	G	3: 14,563,024	E542G	probably damaging	Het
Macc1	T	C	12: 119,447,658		probably benign	Het
Ndst3	T	A	3: 123,552,678	Y234F	possibly damaging	Het
Olfr1477	A	T	19: 13,502,508	H55L	probably damaging	Het
Pes1	T	C	11: 3,977,123	F429S	probably damaging	Het
Polr3e	C	G	7: 120,942,564	D623E	probably damaging	Het
Rapgef6	T	C	11: 54,694,272	Y1494H	probably damaging	Het
Rbm14	T	C	19: 4,801,707		probably benign	Het
Rnf103	A	G	6: 71,510,017	D544G	probably benign	Het
Slc10a7	A	G	8: 78,509,632	I20V	probably damaging	Het
Sort1	C	T	3: 108,346,665	T549I	possibly damaging	Het
Stambpl1	G	A	19: 34,236,354	V328I	probably benign	Het
Thbd	A	G	2: 148,406,364	L528P	probably damaging	Het
Wbp11	A	T	6: 136,824,332	M63K	probably damaging	Het
Wdr11	T	A	7: 129,634,836	I1178N	probably benign	Het

Other mutations in Ift122

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Ift122	APN	6	115917057	missense	probably benign	0.10
IGL00783:Ift122	APN	6	115905902	missense	probably benign
IGL00784:Ift122	APN	6	115905902	missense	probably benign
IGL00799:Ift122	APN	6	115877536	missense	probably damaging	1.00
IGL00908:Ift122	APN	6	115913909	missense	probably benign	0.00
IGL01012:Ift122	APN	6	115899491	missense	probably damaging	0.99
IGL01444:Ift122	APN	6	115884379	missense	probably benign	0.08
IGL01451:Ift122	APN	6	115912604	critical splice donor site	probably null
IGL01940:Ift122	APN	6	115887371	splice site	probably benign
IGL02089:Ift122	APN	6	115925437	missense	probably benign	0.00
IGL02331:Ift122	APN	6	115887324	missense	probably damaging	1.00
IGL02929:Ift122	APN	6	115902877	missense	probably damaging	1.00
IGL03169:Ift122	APN	6	115905961	splice site	probably benign
PIT1430001:Ift122	UTSW	6	115925744	splice site	probably benign
R0158:Ift122	UTSW	6	115924484	splice site	probably benign
R0496:Ift122	UTSW	6	115905902	missense	probably benign
R1065:Ift122	UTSW	6	115875325	splice site	probably null
R1670:Ift122	UTSW	6	115923883	missense	probably benign	0.05
R1861:Ift122	UTSW	6	115891928	missense	probably damaging	1.00
R1889:Ift122	UTSW	6	115894421	critical splice donor site	probably null
R1990:Ift122	UTSW	6	115924367	missense	probably damaging	1.00
R2385:Ift122	UTSW	6	115912522	missense	probably benign	0.21
R3734:Ift122	UTSW	6	115925501	splice site	probably benign
R3800:Ift122	UTSW	6	115925906	missense	probably benign	0.03
R3981:Ift122	UTSW	6	115913921	missense	probably benign	0.02
R4289:Ift122	UTSW	6	115923891	missense	probably damaging	1.00
R4545:Ift122	UTSW	6	115890588	missense	probably damaging	1.00
R4546:Ift122	UTSW	6	115890588	missense	probably damaging	1.00
R4641:Ift122	UTSW	6	115888765	nonsense	probably null
R4815:Ift122	UTSW	6	115881556	missense	possibly damaging	0.95
R4854:Ift122	UTSW	6	115862746	missense	possibly damaging	0.61
R4928:Ift122	UTSW	6	115915858	utr 3 prime	probably benign
R5021:Ift122	UTSW	6	115864372	missense	probably benign	0.41
R5121:Ift122	UTSW	6	115912534	missense	probably benign	0.04
R5200:Ift122	UTSW	6	115920379	missense	probably damaging	0.99
R5549:Ift122	UTSW	6	115892022	missense	probably damaging	1.00
R6111:Ift122	UTSW	6	115875286	missense	probably damaging	1.00
R6141:Ift122	UTSW	6	115916011	missense	probably damaging	0.99
R6766:Ift122	UTSW	6	115926243	missense	probably benign	0.15
R7379:Ift122	UTSW	6	115926302	missense	probably benign
R7402:Ift122	UTSW	6	115894322	missense	probably benign	0.00
R7436:Ift122	UTSW	6	115926302	missense	probably benign
R7437:Ift122	UTSW	6	115926302	missense	probably benign
R7438:Ift122	UTSW	6	115926302	missense	probably benign
R7517:Ift122	UTSW	6	115890582	missense	probably benign	0.37
R7978:Ift122	UTSW	6	115920352	missense	probably benign	0.37
R8492:Ift122	UTSW	6	115887005	missense	probably benign	0.02
R8493:Ift122	UTSW	6	115910331	missense	probably benign	0.01
R8669:Ift122	UTSW	6	115923291	missense	probably damaging	0.98
R8867:Ift122	UTSW	6	115880671	missense	probably damaging	1.00
R8887:Ift122	UTSW	6	115891919	missense	probably benign	0.00
R8947:Ift122	UTSW	6	115924407	missense	probably benign
R8978:Ift122	UTSW	6	115925808	missense	possibly damaging	0.78
R9149:Ift122	UTSW	6	115890531	missense	probably damaging	1.00
R9571:Ift122	UTSW	6	115880667	missense	possibly damaging	0.50
R9573:Ift122	UTSW	6	115880685	missense	probably benign
R9677:Ift122	UTSW	6	115920396	missense	probably benign	0.16
Z1176:Ift122	UTSW	6	115915994	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAATAGCAGATCCCAGGAG -3'
(R):5'- AAAGTCAAGCTCACTATGCAGC -3'

Sequencing Primer
(F):5'- AGGGCCAAACCTGTCTTTG -3'
(R):5'- GCAGCCACTAACAATGATTATGTG -3'

Posted On

2014-10-30