Incidental Mutation 'R2362:Cyp2b19'
ID 247180
Institutional Source Beutler Lab
Gene Symbol Cyp2b19
Ensembl Gene ENSMUSG00000066704
Gene Name cytochrome P450, family 2, subfamily b, polypeptide 19
Synonyms
MMRRC Submission 040343-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R2362 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 26456567-26472055 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26463802 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 318 (Y318C)
Ref Sequence ENSEMBL: ENSMUSP00000077021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077855]
AlphaFold O55071
Predicted Effect probably damaging
Transcript: ENSMUST00000077855
AA Change: Y318C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077021
Gene: ENSMUSG00000066704
AA Change: Y318C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:p450 32 489 8.7e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138018
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,604,442 (GRCm39) M1K probably null Het
Aadat A G 8: 60,985,332 (GRCm39) probably benign Het
Acsm5 T C 7: 119,127,649 (GRCm39) probably benign Het
Avl9 A T 6: 56,713,555 (GRCm39) N271I probably benign Het
Ccdc30 T A 4: 119,181,253 (GRCm39) N636I probably damaging Het
Cdr2 T G 7: 120,569,554 (GRCm39) I62L possibly damaging Het
Ceacam23 T G 7: 17,636,398 (GRCm39) noncoding transcript Het
Clk3 T C 9: 57,661,902 (GRCm39) I382V possibly damaging Het
Ctsr T A 13: 61,310,610 (GRCm39) E45V probably damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dapk1 A G 13: 60,878,745 (GRCm39) N578S probably damaging Het
Dlg5 A T 14: 24,208,755 (GRCm39) M817K probably benign Het
Dtx4 A G 19: 12,469,899 (GRCm39) V76A probably damaging Het
Eps15 T C 4: 109,218,427 (GRCm39) V430A probably benign Het
Fhip2b A G 14: 70,823,805 (GRCm39) Y568H probably benign Het
Fxyd5 T C 7: 30,735,896 (GRCm39) N104S probably benign Het
Ift122 A G 6: 115,861,311 (GRCm39) D193G probably damaging Het
Lrrcc1 A G 3: 14,628,084 (GRCm39) E542G probably damaging Het
Macc1 T C 12: 119,411,393 (GRCm39) probably benign Het
Ndst3 T A 3: 123,346,327 (GRCm39) Y234F possibly damaging Het
Or5b120 A T 19: 13,479,872 (GRCm39) H55L probably damaging Het
Pes1 T C 11: 3,927,123 (GRCm39) F429S probably damaging Het
Polr3e C G 7: 120,541,787 (GRCm39) D623E probably damaging Het
Rapgef6 T C 11: 54,585,098 (GRCm39) Y1494H probably damaging Het
Rbm14 T C 19: 4,851,735 (GRCm39) probably benign Het
Rnf103 A G 6: 71,487,001 (GRCm39) D544G probably benign Het
Slc10a7 A G 8: 79,236,261 (GRCm39) I20V probably damaging Het
Sort1 C T 3: 108,253,981 (GRCm39) T549I possibly damaging Het
Stambpl1 G A 19: 34,213,754 (GRCm39) V328I probably benign Het
Thbd A G 2: 148,248,284 (GRCm39) L528P probably damaging Het
Wbp11 A T 6: 136,801,330 (GRCm39) M63K probably damaging Het
Wdr11 T A 7: 129,236,560 (GRCm39) I1178N probably benign Het
Other mutations in Cyp2b19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Cyp2b19 APN 7 26,462,886 (GRCm39) missense possibly damaging 0.91
IGL01338:Cyp2b19 APN 7 26,458,842 (GRCm39) missense probably benign 0.09
IGL01374:Cyp2b19 APN 7 26,458,504 (GRCm39) missense probably benign 0.06
IGL01613:Cyp2b19 APN 7 26,462,886 (GRCm39) missense possibly damaging 0.91
IGL01695:Cyp2b19 APN 7 26,458,489 (GRCm39) missense probably damaging 1.00
IGL02322:Cyp2b19 APN 7 26,461,803 (GRCm39) missense possibly damaging 0.79
IGL03077:Cyp2b19 APN 7 26,461,809 (GRCm39) missense probably benign
R0047:Cyp2b19 UTSW 7 26,466,251 (GRCm39) missense probably benign 0.01
R0047:Cyp2b19 UTSW 7 26,466,251 (GRCm39) missense probably benign 0.01
R0452:Cyp2b19 UTSW 7 26,466,187 (GRCm39) missense probably benign 0.01
R0865:Cyp2b19 UTSW 7 26,461,654 (GRCm39) splice site probably benign
R1514:Cyp2b19 UTSW 7 26,466,585 (GRCm39) missense probably benign 0.00
R1681:Cyp2b19 UTSW 7 26,462,765 (GRCm39) splice site probably null
R4015:Cyp2b19 UTSW 7 26,461,768 (GRCm39) missense probably damaging 1.00
R4259:Cyp2b19 UTSW 7 26,462,807 (GRCm39) missense probably damaging 1.00
R4592:Cyp2b19 UTSW 7 26,470,819 (GRCm39) missense probably benign 0.04
R4705:Cyp2b19 UTSW 7 26,456,717 (GRCm39) missense probably benign 0.03
R4789:Cyp2b19 UTSW 7 26,463,801 (GRCm39) missense probably benign 0.16
R5481:Cyp2b19 UTSW 7 26,466,246 (GRCm39) missense probably damaging 0.99
R5749:Cyp2b19 UTSW 7 26,462,844 (GRCm39) missense possibly damaging 0.84
R6041:Cyp2b19 UTSW 7 26,458,852 (GRCm39) missense probably damaging 1.00
R6170:Cyp2b19 UTSW 7 26,458,519 (GRCm39) missense possibly damaging 0.80
R6259:Cyp2b19 UTSW 7 26,470,817 (GRCm39) missense possibly damaging 0.91
R6370:Cyp2b19 UTSW 7 26,462,783 (GRCm39) missense probably benign 0.07
R6519:Cyp2b19 UTSW 7 26,458,536 (GRCm39) missense probably benign
R6656:Cyp2b19 UTSW 7 26,466,280 (GRCm39) missense probably benign
R7283:Cyp2b19 UTSW 7 26,466,339 (GRCm39) missense probably damaging 1.00
R7583:Cyp2b19 UTSW 7 26,458,489 (GRCm39) missense probably damaging 1.00
R7686:Cyp2b19 UTSW 7 26,461,768 (GRCm39) missense probably damaging 1.00
R7732:Cyp2b19 UTSW 7 26,470,769 (GRCm39) missense possibly damaging 0.67
R7831:Cyp2b19 UTSW 7 26,466,565 (GRCm39) missense possibly damaging 0.80
R8035:Cyp2b19 UTSW 7 26,470,675 (GRCm39) missense probably damaging 1.00
R8853:Cyp2b19 UTSW 7 26,456,645 (GRCm39) missense possibly damaging 0.53
R9574:Cyp2b19 UTSW 7 26,466,353 (GRCm39) missense probably null 1.00
R9574:Cyp2b19 UTSW 7 26,466,352 (GRCm39) missense probably damaging 1.00
R9650:Cyp2b19 UTSW 7 26,466,208 (GRCm39) missense possibly damaging 0.85
R9681:Cyp2b19 UTSW 7 26,466,328 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGCACAGTGACTAGAAAGGC -3'
(R):5'- CAGAAAACAAGTCAGCTGATTGC -3'

Sequencing Primer
(F):5'- GAAAGGCTCATGTTTCTCACTGCAAG -3'
(R):5'- GCTGATTGCTCATTCACATACCAC -3'
Posted On 2014-10-30