Incidental Mutation 'R2362:Fxyd5'
ID247181
Institutional Source Beutler Lab
Gene Symbol Fxyd5
Ensembl Gene ENSMUSG00000009687
Gene NameFXYD domain-containing ion transport regulator 5
SynonymsEF-8, Oit2
MMRRC Submission 040343-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R2362 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location31032722-31042481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31036471 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 104 (N104S)
Ref Sequence ENSEMBL: ENSMUSP00000144377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009831] [ENSMUST00000159753] [ENSMUST00000159924] [ENSMUST00000160689] [ENSMUST00000161684] [ENSMUST00000161805] [ENSMUST00000162087] [ENSMUST00000162116] [ENSMUST00000162733] [ENSMUST00000202395]
Predicted Effect probably benign
Transcript: ENSMUST00000009831
AA Change: N117S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000009831
Gene: ENSMUSG00000009687
AA Change: N117S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 130 176 8.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159753
SMART Domains Protein: ENSMUSP00000123813
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159924
AA Change: N116S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124219
Gene: ENSMUSG00000009687
AA Change: N116S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160006
Predicted Effect probably benign
Transcript: ENSMUST00000160689
SMART Domains Protein: ENSMUSP00000125187
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161259
Predicted Effect probably benign
Transcript: ENSMUST00000161684
AA Change: N116S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125285
Gene: ENSMUSG00000009687
AA Change: N116S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161805
AA Change: N116S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125398
Gene: ENSMUSG00000009687
AA Change: N116S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162087
AA Change: N116S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125065
Gene: ENSMUSG00000009687
AA Change: N116S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 130 174 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162116
AA Change: N116S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124203
Gene: ENSMUSG00000009687
AA Change: N116S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000162250
AA Change: N54S
SMART Domains Protein: ENSMUSP00000124129
Gene: ENSMUSG00000009687
AA Change: N54S

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 69 113 7.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162733
AA Change: N117S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125173
Gene: ENSMUSG00000009687
AA Change: N117S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 131 167 6.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184636
Predicted Effect probably benign
Transcript: ENSMUST00000202395
AA Change: N104S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144377
Gene: ENSMUSG00000009687
AA Change: N104S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205301
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is member of the FXYD family of transmembrane glycoproteins. Like most members of the FXYD family, the encoded protein is a subunit of the sodium-potassium adenosine triphosphatase pump. FXYD family members have tissue-specific expression and differentially regulate the activity of this pump. The protein encoded by this gene also plays a role in cell adhesion and motility. The orthologous human protein inhibits epithelial cadherin, a calcium-dependent adhesion protein and is associated with cancer (promotes metastasis). Alternative splicing of this mouse gene results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Aadat A G 8: 60,532,298 probably benign Het
Acsm5 T C 7: 119,528,426 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Cdr2 T G 7: 120,970,331 I62L possibly damaging Het
Clk3 T C 9: 57,754,619 I382V possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fam160b2 A G 14: 70,586,365 Y568H probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Ift122 A G 6: 115,884,350 D193G probably damaging Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Olfr1477 A T 19: 13,502,508 H55L probably damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Polr3e C G 7: 120,942,564 D623E probably damaging Het
Rapgef6 T C 11: 54,694,272 Y1494H probably damaging Het
Rbm14 T C 19: 4,801,707 probably benign Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Slc10a7 A G 8: 78,509,632 I20V probably damaging Het
Sort1 C T 3: 108,346,665 T549I possibly damaging Het
Stambpl1 G A 19: 34,236,354 V328I probably benign Het
Thbd A G 2: 148,406,364 L528P probably damaging Het
Wbp11 A T 6: 136,824,332 M63K probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Fxyd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01910:Fxyd5 APN 7 31035218 missense probably damaging 0.96
IGL01913:Fxyd5 APN 7 31035212 missense probably damaging 0.99
IGL02071:Fxyd5 APN 7 31040188 missense possibly damaging 0.46
IGL02800:Fxyd5 APN 7 31032979 missense possibly damaging 0.95
R1812:Fxyd5 UTSW 7 31037930 critical splice acceptor site probably null
R3690:Fxyd5 UTSW 7 31036439 missense possibly damaging 0.95
R4279:Fxyd5 UTSW 7 31035386 missense probably null 1.00
R4786:Fxyd5 UTSW 7 31041482 unclassified probably benign
R6410:Fxyd5 UTSW 7 31035406 missense probably damaging 1.00
R6465:Fxyd5 UTSW 7 31037880 missense probably damaging 0.96
R7257:Fxyd5 UTSW 7 31035151 missense unknown
R7309:Fxyd5 UTSW 7 31035404 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGATGACCTGGTTGGCTCC -3'
(R):5'- TTGTTAGCGGAGGTCCAAAAG -3'

Sequencing Primer
(F):5'- TGGCTCCATGGCACTTAGG -3'
(R):5'- CAAAAGAGGGACCCGCCTG -3'
Posted On2014-10-30