Incidental Mutation 'R2362:Fxyd5'
ID 247181
Institutional Source Beutler Lab
Gene Symbol Fxyd5
Ensembl Gene ENSMUSG00000009687
Gene Name FXYD domain-containing ion transport regulator 5
Synonyms dysadherin, Oit2, EF-8
MMRRC Submission 040343-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R2362 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 30732153-30741565 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30735896 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 104 (N104S)
Ref Sequence ENSEMBL: ENSMUSP00000144377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009831] [ENSMUST00000159753] [ENSMUST00000159924] [ENSMUST00000160689] [ENSMUST00000162733] [ENSMUST00000162087] [ENSMUST00000202395] [ENSMUST00000161684] [ENSMUST00000161805] [ENSMUST00000162116]
AlphaFold P97808
Predicted Effect probably benign
Transcript: ENSMUST00000009831
AA Change: N117S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000009831
Gene: ENSMUSG00000009687
AA Change: N117S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 130 176 8.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159753
SMART Domains Protein: ENSMUSP00000123813
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159924
AA Change: N116S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124219
Gene: ENSMUSG00000009687
AA Change: N116S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160006
Predicted Effect probably benign
Transcript: ENSMUST00000160689
SMART Domains Protein: ENSMUSP00000125187
Gene: ENSMUSG00000009687

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161259
Predicted Effect probably benign
Transcript: ENSMUST00000162733
AA Change: N117S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125173
Gene: ENSMUSG00000009687
AA Change: N117S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 131 167 6.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162087
AA Change: N116S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125065
Gene: ENSMUSG00000009687
AA Change: N116S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 130 174 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202395
AA Change: N104S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144377
Gene: ENSMUSG00000009687
AA Change: N104S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161684
AA Change: N116S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125285
Gene: ENSMUSG00000009687
AA Change: N116S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161805
AA Change: N116S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125398
Gene: ENSMUSG00000009687
AA Change: N116S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162116
AA Change: N116S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124203
Gene: ENSMUSG00000009687
AA Change: N116S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 129 175 8.5e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000162250
AA Change: N54S
SMART Domains Protein: ENSMUSP00000124129
Gene: ENSMUSG00000009687
AA Change: N54S

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 69 113 7.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184636
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is member of the FXYD family of transmembrane glycoproteins. Like most members of the FXYD family, the encoded protein is a subunit of the sodium-potassium adenosine triphosphatase pump. FXYD family members have tissue-specific expression and differentially regulate the activity of this pump. The protein encoded by this gene also plays a role in cell adhesion and motility. The orthologous human protein inhibits epithelial cadherin, a calcium-dependent adhesion protein and is associated with cancer (promotes metastasis). Alternative splicing of this mouse gene results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,604,442 (GRCm39) M1K probably null Het
Aadat A G 8: 60,985,332 (GRCm39) probably benign Het
Acsm5 T C 7: 119,127,649 (GRCm39) probably benign Het
Avl9 A T 6: 56,713,555 (GRCm39) N271I probably benign Het
Ccdc30 T A 4: 119,181,253 (GRCm39) N636I probably damaging Het
Cdr2 T G 7: 120,569,554 (GRCm39) I62L possibly damaging Het
Ceacam23 T G 7: 17,636,398 (GRCm39) noncoding transcript Het
Clk3 T C 9: 57,661,902 (GRCm39) I382V possibly damaging Het
Ctsr T A 13: 61,310,610 (GRCm39) E45V probably damaging Het
Cyp2b19 A G 7: 26,463,802 (GRCm39) Y318C probably damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dapk1 A G 13: 60,878,745 (GRCm39) N578S probably damaging Het
Dlg5 A T 14: 24,208,755 (GRCm39) M817K probably benign Het
Dtx4 A G 19: 12,469,899 (GRCm39) V76A probably damaging Het
Eps15 T C 4: 109,218,427 (GRCm39) V430A probably benign Het
Fhip2b A G 14: 70,823,805 (GRCm39) Y568H probably benign Het
Ift122 A G 6: 115,861,311 (GRCm39) D193G probably damaging Het
Lrrcc1 A G 3: 14,628,084 (GRCm39) E542G probably damaging Het
Macc1 T C 12: 119,411,393 (GRCm39) probably benign Het
Ndst3 T A 3: 123,346,327 (GRCm39) Y234F possibly damaging Het
Or5b120 A T 19: 13,479,872 (GRCm39) H55L probably damaging Het
Pes1 T C 11: 3,927,123 (GRCm39) F429S probably damaging Het
Polr3e C G 7: 120,541,787 (GRCm39) D623E probably damaging Het
Rapgef6 T C 11: 54,585,098 (GRCm39) Y1494H probably damaging Het
Rbm14 T C 19: 4,851,735 (GRCm39) probably benign Het
Rnf103 A G 6: 71,487,001 (GRCm39) D544G probably benign Het
Slc10a7 A G 8: 79,236,261 (GRCm39) I20V probably damaging Het
Sort1 C T 3: 108,253,981 (GRCm39) T549I possibly damaging Het
Stambpl1 G A 19: 34,213,754 (GRCm39) V328I probably benign Het
Thbd A G 2: 148,248,284 (GRCm39) L528P probably damaging Het
Wbp11 A T 6: 136,801,330 (GRCm39) M63K probably damaging Het
Wdr11 T A 7: 129,236,560 (GRCm39) I1178N probably benign Het
Other mutations in Fxyd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01910:Fxyd5 APN 7 30,734,643 (GRCm39) missense probably damaging 0.96
IGL01913:Fxyd5 APN 7 30,734,637 (GRCm39) missense probably damaging 0.99
IGL02071:Fxyd5 APN 7 30,739,613 (GRCm39) missense possibly damaging 0.46
IGL02800:Fxyd5 APN 7 30,732,404 (GRCm39) missense possibly damaging 0.95
Uptown UTSW 7 30,740,854 (GRCm39) missense probably damaging 1.00
R1812:Fxyd5 UTSW 7 30,737,355 (GRCm39) critical splice acceptor site probably null
R3690:Fxyd5 UTSW 7 30,735,864 (GRCm39) missense possibly damaging 0.95
R4279:Fxyd5 UTSW 7 30,734,811 (GRCm39) missense probably null 1.00
R4786:Fxyd5 UTSW 7 30,740,907 (GRCm39) unclassified probably benign
R6410:Fxyd5 UTSW 7 30,734,831 (GRCm39) missense probably damaging 1.00
R6465:Fxyd5 UTSW 7 30,737,305 (GRCm39) missense probably damaging 0.96
R7257:Fxyd5 UTSW 7 30,734,576 (GRCm39) missense unknown
R7309:Fxyd5 UTSW 7 30,734,829 (GRCm39) missense probably benign 0.00
R8270:Fxyd5 UTSW 7 30,740,854 (GRCm39) missense probably damaging 1.00
Z1186:Fxyd5 UTSW 7 30,737,356 (GRCm39) missense possibly damaging 0.88
Z1186:Fxyd5 UTSW 7 30,734,588 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATGATGACCTGGTTGGCTCC -3'
(R):5'- TTGTTAGCGGAGGTCCAAAAG -3'

Sequencing Primer
(F):5'- TGGCTCCATGGCACTTAGG -3'
(R):5'- CAAAAGAGGGACCCGCCTG -3'
Posted On 2014-10-30