Incidental Mutation 'R2362:Acsm5'
ID247183
Institutional Source Beutler Lab
Gene Symbol Acsm5
Ensembl Gene ENSMUSG00000030972
Gene Nameacyl-CoA synthetase medium-chain family member 5
SynonymsC730027J19Rik
MMRRC Submission 040343-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R2362 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119519463-119545551 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 119528426 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033267] [ENSMUST00000066465] [ENSMUST00000207307] [ENSMUST00000207381] [ENSMUST00000207387] [ENSMUST00000207440] [ENSMUST00000207796] [ENSMUST00000207813]
Predicted Effect probably benign
Transcript: ENSMUST00000033267
SMART Domains Protein: ENSMUSP00000033267
Gene: ENSMUSG00000030968

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 86 97 N/A INTRINSIC
Pfam:Thioredoxin_6 177 362 6e-35 PFAM
Pfam:Thioredoxin 385 489 3.7e-16 PFAM
low complexity region 495 512 N/A INTRINSIC
low complexity region 551 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066465
SMART Domains Protein: ENSMUSP00000063416
Gene: ENSMUSG00000030972

DomainStartEndE-ValueType
low complexity region 26 32 N/A INTRINSIC
Pfam:AMP-binding 65 477 2.9e-78 PFAM
Pfam:AMP-binding_C 485 565 3.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207307
Predicted Effect probably benign
Transcript: ENSMUST00000207381
Predicted Effect probably benign
Transcript: ENSMUST00000207387
Predicted Effect probably benign
Transcript: ENSMUST00000207440
Predicted Effect probably benign
Transcript: ENSMUST00000207796
Predicted Effect probably benign
Transcript: ENSMUST00000207813
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Aadat A G 8: 60,532,298 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Cdr2 T G 7: 120,970,331 I62L possibly damaging Het
Clk3 T C 9: 57,754,619 I382V possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fam160b2 A G 14: 70,586,365 Y568H probably benign Het
Fxyd5 T C 7: 31,036,471 N104S probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Ift122 A G 6: 115,884,350 D193G probably damaging Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Olfr1477 A T 19: 13,502,508 H55L probably damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Polr3e C G 7: 120,942,564 D623E probably damaging Het
Rapgef6 T C 11: 54,694,272 Y1494H probably damaging Het
Rbm14 T C 19: 4,801,707 probably benign Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Slc10a7 A G 8: 78,509,632 I20V probably damaging Het
Sort1 C T 3: 108,346,665 T549I possibly damaging Het
Stambpl1 G A 19: 34,236,354 V328I probably benign Het
Thbd A G 2: 148,406,364 L528P probably damaging Het
Wbp11 A T 6: 136,824,332 M63K probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Acsm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Acsm5 APN 7 119542438 critical splice donor site probably null
IGL01662:Acsm5 APN 7 119538288 missense probably damaging 1.00
IGL02228:Acsm5 APN 7 119531866 missense probably damaging 1.00
IGL02380:Acsm5 APN 7 119537286 missense probably benign 0.05
IGL02709:Acsm5 APN 7 119534818 nonsense probably null
P4717OSA:Acsm5 UTSW 7 119531972 missense probably benign 0.12
R0506:Acsm5 UTSW 7 119538096 nonsense probably null
R0518:Acsm5 UTSW 7 119535800 missense possibly damaging 0.95
R0866:Acsm5 UTSW 7 119540900 missense probably damaging 0.99
R1171:Acsm5 UTSW 7 119540852 missense probably damaging 0.99
R2511:Acsm5 UTSW 7 119530454 missense possibly damaging 0.80
R4670:Acsm5 UTSW 7 119531760 splice site probably null
R4908:Acsm5 UTSW 7 119538091 missense probably damaging 1.00
R4913:Acsm5 UTSW 7 119534343 missense probably damaging 0.98
R5038:Acsm5 UTSW 7 119534811 missense probably damaging 1.00
R5112:Acsm5 UTSW 7 119537279 missense possibly damaging 0.95
R6337:Acsm5 UTSW 7 119534235 missense probably benign 0.00
R6481:Acsm5 UTSW 7 119534881 missense probably benign 0.02
R7268:Acsm5 UTSW 7 119537288 missense probably benign 0.38
R7275:Acsm5 UTSW 7 119537288 missense possibly damaging 0.81
R7509:Acsm5 UTSW 7 119534388 missense probably benign
R7794:Acsm5 UTSW 7 119538129 unclassified probably benign
R8021:Acsm5 UTSW 7 119542393 missense possibly damaging 0.72
R8178:Acsm5 UTSW 7 119542395 missense probably damaging 1.00
Z1088:Acsm5 UTSW 7 119537211 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCAGACCCTGATACAGAGAG -3'
(R):5'- GATGAGCCTCACCTTTTCCAG -3'

Sequencing Primer
(F):5'- GAGGTAGGAGAGGACTTCCC -3'
(R):5'- CATCATGAGCAAAGTTGAAGTACTCG -3'
Posted On2014-10-30