Incidental Mutation 'R2362:Aadat'
ID 247187
Institutional Source Beutler Lab
Gene Symbol Aadat
Ensembl Gene ENSMUSG00000057228
Gene Name aminoadipate aminotransferase
Synonyms KATII, Kat2, mKat-2
MMRRC Submission 040343-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2362 (G1)
Quality Score 147
Status Validated
Chromosome 8
Chromosomal Location 60505932-60545677 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 60532298 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079472] [ENSMUST00000209338]
AlphaFold Q9WVM8
Predicted Effect probably benign
Transcript: ENSMUST00000079472
SMART Domains Protein: ENSMUSP00000078436
Gene: ENSMUSG00000057228

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 64 417 2.6e-22 PFAM
Pfam:Aminotran_MocR 124 424 7.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209338
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to mouse and rat kynurenine aminotransferase II. The rat protein is a homodimer with two transaminase activities. One activity is the transamination of alpha-aminoadipic acid, a final step in the saccaropine pathway which is the major pathway for L-lysine catabolism. The other activity involves the transamination of kynurenine to produce kynurenine acid, the precursor of kynurenic acid which has neuroprotective properties. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous null mice are viable and display earlier eye opening and development of air righting and open field crossing responses, and transient hyperactivity and neuronal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Acsm5 T C 7: 119,528,426 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Cdr2 T G 7: 120,970,331 I62L possibly damaging Het
Clk3 T C 9: 57,754,619 I382V possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fam160b2 A G 14: 70,586,365 Y568H probably benign Het
Fxyd5 T C 7: 31,036,471 N104S probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Ift122 A G 6: 115,884,350 D193G probably damaging Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Olfr1477 A T 19: 13,502,508 H55L probably damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Polr3e C G 7: 120,942,564 D623E probably damaging Het
Rapgef6 T C 11: 54,694,272 Y1494H probably damaging Het
Rbm14 T C 19: 4,801,707 probably benign Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Slc10a7 A G 8: 78,509,632 I20V probably damaging Het
Sort1 C T 3: 108,346,665 T549I possibly damaging Het
Stambpl1 G A 19: 34,236,354 V328I probably benign Het
Thbd A G 2: 148,406,364 L528P probably damaging Het
Wbp11 A T 6: 136,824,332 M63K probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Aadat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Aadat APN 8 60535758 missense probably benign 0.11
IGL01123:Aadat APN 8 60526614 missense probably benign 0.14
IGL01524:Aadat APN 8 60516072 missense probably damaging 0.97
IGL01767:Aadat APN 8 60507092 missense probably damaging 0.96
IGL02824:Aadat APN 8 60516022 missense probably benign 0.01
IGL03150:Aadat APN 8 60543562 missense probably damaging 0.97
IGL03356:Aadat APN 8 60531691 missense probably damaging 1.00
R0015:Aadat UTSW 8 60534571 splice site probably benign
R0294:Aadat UTSW 8 60534608 missense possibly damaging 0.77
R0533:Aadat UTSW 8 60531763 splice site probably benign
R0631:Aadat UTSW 8 60529445 splice site probably benign
R1585:Aadat UTSW 8 60526680 missense possibly damaging 0.67
R1728:Aadat UTSW 8 60526712 missense probably damaging 1.00
R1729:Aadat UTSW 8 60526712 missense probably damaging 1.00
R2051:Aadat UTSW 8 60507139 missense probably benign 0.00
R3971:Aadat UTSW 8 60518581 missense probably damaging 1.00
R4126:Aadat UTSW 8 60531669 missense probably benign 0.00
R4736:Aadat UTSW 8 60540106 missense probably benign 0.30
R4739:Aadat UTSW 8 60540106 missense probably benign 0.30
R4750:Aadat UTSW 8 60526600 missense probably benign 0.10
R4874:Aadat UTSW 8 60516113 critical splice donor site probably null
R4884:Aadat UTSW 8 60526629 missense probably damaging 1.00
R5233:Aadat UTSW 8 60526622 missense probably benign 0.01
R5367:Aadat UTSW 8 60526596 missense probably damaging 1.00
R6920:Aadat UTSW 8 60529433 missense probably damaging 0.97
R7064:Aadat UTSW 8 60531712 missense probably damaging 1.00
R7194:Aadat UTSW 8 60526622 missense probably benign 0.01
R7316:Aadat UTSW 8 60526634 missense probably damaging 0.98
R7634:Aadat UTSW 8 60516068 missense probably benign 0.09
R8672:Aadat UTSW 8 60506145 unclassified probably benign
R8711:Aadat UTSW 8 60516086 missense probably benign 0.01
R8803:Aadat UTSW 8 60545256 missense probably benign 0.14
R8919:Aadat UTSW 8 60540124 missense possibly damaging 0.94
R9204:Aadat UTSW 8 60543532 missense possibly damaging 0.90
R9207:Aadat UTSW 8 60526623 missense probably damaging 1.00
R9313:Aadat UTSW 8 60526601 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GATATCTTTGCCCCTGAGCC -3'
(R):5'- AGGACTCTGGACAGGCAATATC -3'

Sequencing Primer
(F):5'- GAGCCATCTCTCTTCTGGTGGAATC -3'
(R):5'- TCTTCCCTGTCAGGTTAAG -3'
Posted On 2014-10-30