Incidental Mutation 'R2362:Clk3'
ID 247189
Institutional Source Beutler Lab
Gene Symbol Clk3
Ensembl Gene ENSMUSG00000032316
Gene Name CDC-like kinase 3
Synonyms
MMRRC Submission 040343-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock # R2362 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 57750624-57765860 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57754619 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 382 (I382V)
Ref Sequence ENSEMBL: ENSMUSP00000067341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043990] [ENSMUST00000065330] [ENSMUST00000137245]
AlphaFold O35492
Predicted Effect probably benign
Transcript: ENSMUST00000043990
SMART Domains Protein: ENSMUSP00000049146
Gene: ENSMUSG00000038957

DomainStartEndE-ValueType
LSM14 1 80 9.12e-20 SMART
Pfam:Edc3_linker 102 197 1.9e-47 PFAM
FDF 198 301 1.84e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000065330
AA Change: I382V

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067341
Gene: ENSMUSG00000032316
AA Change: I382V

DomainStartEndE-ValueType
low complexity region 57 73 N/A INTRINSIC
low complexity region 122 147 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
low complexity region 181 199 N/A INTRINSIC
low complexity region 234 252 N/A INTRINSIC
low complexity region 261 283 N/A INTRINSIC
S_TKc 304 620 5.56e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137245
SMART Domains Protein: ENSMUSP00000123317
Gene: ENSMUSG00000038957

DomainStartEndE-ValueType
Pfam:LSM14 1 56 3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215109
Predicted Effect unknown
Transcript: ENSMUST00000215233
AA Change: I247V
Predicted Effect unknown
Transcript: ENSMUST00000215333
AA Change: I40V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216095
Predicted Effect probably benign
Transcript: ENSMUST00000217409
Meta Mutation Damage Score 0.1510 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the serine/threonine type protein kinase family. This protein is a nuclear dual-specificity kinase that regulates the intranuclear distribution of the serine/arginine-rich (SR) family of splicing factors. Two transcript variants encoding different isoforms have been found for this gene. Related pseudogenes are located on chromosomes 1 and 9. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Aadat A G 8: 60,532,298 probably benign Het
Acsm5 T C 7: 119,528,426 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Cdr2 T G 7: 120,970,331 I62L possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fam160b2 A G 14: 70,586,365 Y568H probably benign Het
Fxyd5 T C 7: 31,036,471 N104S probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Ift122 A G 6: 115,884,350 D193G probably damaging Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Olfr1477 A T 19: 13,502,508 H55L probably damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Polr3e C G 7: 120,942,564 D623E probably damaging Het
Rapgef6 T C 11: 54,694,272 Y1494H probably damaging Het
Rbm14 T C 19: 4,801,707 probably benign Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Slc10a7 A G 8: 78,509,632 I20V probably damaging Het
Sort1 C T 3: 108,346,665 T549I possibly damaging Het
Stambpl1 G A 19: 34,236,354 V328I probably benign Het
Thbd A G 2: 148,406,364 L528P probably damaging Het
Wbp11 A T 6: 136,824,332 M63K probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Clk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Clk3 APN 9 57754592 missense probably damaging 1.00
IGL01654:Clk3 APN 9 57751763 missense probably damaging 1.00
IGL02506:Clk3 APN 9 57754644 nonsense probably null
R0062:Clk3 UTSW 9 57752166 missense probably damaging 1.00
R0062:Clk3 UTSW 9 57752166 missense probably damaging 1.00
R0731:Clk3 UTSW 9 57751126 unclassified probably benign
R1944:Clk3 UTSW 9 57765186 missense probably benign 0.27
R2060:Clk3 UTSW 9 57751117 missense probably damaging 1.00
R4380:Clk3 UTSW 9 57751792 missense probably damaging 1.00
R5395:Clk3 UTSW 9 57753339 missense probably damaging 1.00
R5422:Clk3 UTSW 9 57765438 missense probably benign
R6652:Clk3 UTSW 9 57761795 missense probably damaging 0.99
R6828:Clk3 UTSW 9 57760849 missense possibly damaging 0.87
R6933:Clk3 UTSW 9 57761849 missense probably damaging 1.00
R7343:Clk3 UTSW 9 57760956 missense probably damaging 0.97
R7585:Clk3 UTSW 9 57761836 missense probably damaging 1.00
R8395:Clk3 UTSW 9 57765162 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGAACCTTTCAGCCAGACG -3'
(R):5'- CAGTTCTTGCTAAGCACATGGG -3'

Sequencing Primer
(F):5'- CTAGGCCTGTAAGACCTTGTAGAATG -3'
(R):5'- ACATGGGTGTGGTAGTGGATTG -3'
Posted On 2014-10-30