Incidental Mutation 'R2362:Rapgef6'
ID247192
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene NameRap guanine nucleotide exchange factor (GEF) 6
SynonymsPDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
MMRRC Submission 040343-MU
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2362 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location54522847-54699285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54694272 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1494 (Y1494H)
Ref Sequence ENSEMBL: ENSMUSP00000099804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000207429]
Predicted Effect probably damaging
Transcript: ENSMUST00000101206
AA Change: Y1502H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: Y1502H

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102743
AA Change: Y1494H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: Y1494H

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136494
SMART Domains Protein: ENSMUSP00000114574
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
low complexity region 47 55 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207429
AA Change: Y1499H

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.404 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Aadat A G 8: 60,532,298 probably benign Het
Acsm5 T C 7: 119,528,426 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Cdr2 T G 7: 120,970,331 I62L possibly damaging Het
Clk3 T C 9: 57,754,619 I382V possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fam160b2 A G 14: 70,586,365 Y568H probably benign Het
Fxyd5 T C 7: 31,036,471 N104S probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Ift122 A G 6: 115,884,350 D193G probably damaging Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Olfr1477 A T 19: 13,502,508 H55L probably damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Polr3e C G 7: 120,942,564 D623E probably damaging Het
Rbm14 T C 19: 4,801,707 probably benign Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Slc10a7 A G 8: 78,509,632 I20V probably damaging Het
Sort1 C T 3: 108,346,665 T549I possibly damaging Het
Stambpl1 G A 19: 34,236,354 V328I probably benign Het
Thbd A G 2: 148,406,364 L528P probably damaging Het
Wbp11 A T 6: 136,824,332 M63K probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54679377 missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54691620 missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54691699 missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 intron probably null
R1530:Rapgef6 UTSW 11 54661183 missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1629:Rapgef6 UTSW 11 54546397 frame shift probably null
R1630:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54546397 frame shift probably null
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54546397 frame shift probably null
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54552858 missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54668686 missense probably benign 0.17
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54687711 missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54636163 missense probably benign
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54622317 missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 intron probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54676363 missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54546426 missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54691239 missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54610921 critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54620004 missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54636171 missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54634961 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTCTGGCTTCATGTAGCTG -3'
(R):5'- TGGGATCCAATCTTCGAGGG -3'

Sequencing Primer
(F):5'- CTCTGGCTTCATGTAGCTGTCTATG -3'
(R):5'- TGGCGGCAGTCTAGACAG -3'
Posted On2014-10-30