Incidental Mutation 'R2362:Fam160b2'
ID 247197
Institutional Source Beutler Lab
Gene Symbol Fam160b2
Ensembl Gene ENSMUSG00000022095
Gene Name family with sequence similarity 160, member B2
Synonyms Rai16, G430067P06Rik
MMRRC Submission 040343-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock # R2362 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 70583296-70599835 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70586365 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 568 (Y568H)
Ref Sequence ENSEMBL: ENSMUSP00000022690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022690] [ENSMUST00000089049] [ENSMUST00000228554]
AlphaFold Q80YR2
Predicted Effect probably benign
Transcript: ENSMUST00000022690
AA Change: Y568H

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022690
Gene: ENSMUSG00000022095
AA Change: Y568H

DomainStartEndE-ValueType
Pfam:RAI16-like 79 477 7.7e-112 PFAM
low complexity region 516 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089049
SMART Domains Protein: ENSMUSP00000086450
Gene: ENSMUSG00000045211

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:NUDIX 44 165 2.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228554
Meta Mutation Damage Score 0.0651 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Aadat A G 8: 60,532,298 probably benign Het
Acsm5 T C 7: 119,528,426 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Cdr2 T G 7: 120,970,331 I62L possibly damaging Het
Clk3 T C 9: 57,754,619 I382V possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fxyd5 T C 7: 31,036,471 N104S probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Ift122 A G 6: 115,884,350 D193G probably damaging Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Olfr1477 A T 19: 13,502,508 H55L probably damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Polr3e C G 7: 120,942,564 D623E probably damaging Het
Rapgef6 T C 11: 54,694,272 Y1494H probably damaging Het
Rbm14 T C 19: 4,801,707 probably benign Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Slc10a7 A G 8: 78,509,632 I20V probably damaging Het
Sort1 C T 3: 108,346,665 T549I possibly damaging Het
Stambpl1 G A 19: 34,236,354 V328I probably benign Het
Thbd A G 2: 148,406,364 L528P probably damaging Het
Wbp11 A T 6: 136,824,332 M63K probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Fam160b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Fam160b2 APN 14 70585373 missense probably damaging 1.00
IGL01862:Fam160b2 APN 14 70587690 missense probably benign 0.03
IGL02306:Fam160b2 APN 14 70588997 missense probably benign
IGL02534:Fam160b2 APN 14 70585688 missense probably damaging 0.98
IGL02534:Fam160b2 APN 14 70586190 missense probably benign
IGL03071:Fam160b2 APN 14 70586209 missense probably damaging 1.00
IGL03162:Fam160b2 APN 14 70587554 missense probably damaging 1.00
IGL03166:Fam160b2 APN 14 70590176 missense probably damaging 1.00
IGL03134:Fam160b2 UTSW 14 70588709 missense possibly damaging 0.66
R0043:Fam160b2 UTSW 14 70588661 missense probably benign 0.45
R0628:Fam160b2 UTSW 14 70587721 missense possibly damaging 0.48
R0691:Fam160b2 UTSW 14 70588287 missense probably damaging 1.00
R1680:Fam160b2 UTSW 14 70586851 missense probably damaging 1.00
R1727:Fam160b2 UTSW 14 70593998 missense probably damaging 0.98
R2059:Fam160b2 UTSW 14 70585049 missense possibly damaging 0.54
R3423:Fam160b2 UTSW 14 70586585 missense probably damaging 1.00
R4233:Fam160b2 UTSW 14 70586878 missense probably damaging 0.99
R4770:Fam160b2 UTSW 14 70588287 missense probably damaging 1.00
R5903:Fam160b2 UTSW 14 70591681 missense probably damaging 1.00
R6217:Fam160b2 UTSW 14 70591758 splice site probably null
R6665:Fam160b2 UTSW 14 70585638 missense probably damaging 1.00
R7424:Fam160b2 UTSW 14 70594007 missense probably damaging 1.00
R9176:Fam160b2 UTSW 14 70589100 missense probably benign 0.40
R9393:Fam160b2 UTSW 14 70594023 nonsense probably null
Z1176:Fam160b2 UTSW 14 70586204 missense not run
Z1177:Fam160b2 UTSW 14 70586204 missense not run
Predicted Primers PCR Primer
(F):5'- CCTTTCAGGCTCATGAGAGTC -3'
(R):5'- GGCAGTTGGAGTCACCTGAATC -3'

Sequencing Primer
(F):5'- CTCATGAGAGTCCAAGGGC -3'
(R):5'- CAGTTGGAGTCACCTGAATCATATTC -3'
Posted On 2014-10-30