Incidental Mutation 'R2362:Rbm14'
ID247198
Institutional Source Beutler Lab
Gene Symbol Rbm14
Ensembl Gene ENSMUSG00000006456
Gene NameRNA binding motif protein 14
SynonymsPSP2, 1300007E16Rik, p16
MMRRC Submission 040343-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2362 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4800569-4811634 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 4801707 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006625] [ENSMUST00000113793] [ENSMUST00000172000] [ENSMUST00000178353] [ENSMUST00000179909] [ENSMUST00000180008]
Predicted Effect unknown
Transcript: ENSMUST00000006625
AA Change: D634G
SMART Domains Protein: ENSMUSP00000006625
Gene: ENSMUSG00000006456
AA Change: D634G

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
RRM 80 145 2.52e-20 SMART
low complexity region 212 225 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
low complexity region 368 458 N/A INTRINSIC
low complexity region 483 511 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113793
SMART Domains Protein: ENSMUSP00000109424
Gene: ENSMUSG00000006456

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
RRM 80 145 2.52e-20 SMART
low complexity region 212 225 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
low complexity region 368 458 N/A INTRINSIC
low complexity region 483 511 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172000
SMART Domains Protein: ENSMUSP00000128810
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 116 1.5e-5 PFAM
RRM 119 184 5.4e-20 SMART
RRM 195 260 4.77e-21 SMART
ZnF_C2HC 277 293 1.75e-5 SMART
low complexity region 343 362 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177776
Predicted Effect probably benign
Transcript: ENSMUST00000178353
SMART Domains Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 5.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178727
Predicted Effect probably benign
Transcript: ENSMUST00000179909
SMART Domains Protein: ENSMUSP00000136623
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
RRM 80 138 1.83e0 SMART
ZnF_C2HC 136 152 1.75e-5 SMART
low complexity region 202 221 N/A INTRINSIC
low complexity region 258 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180008
SMART Domains Protein: ENSMUSP00000137466
Gene: ENSMUSG00000006456

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 6e-7 PFAM
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribonucleoprotein that functions as a general nuclear coactivator, and an RNA splicing modulator. This protein contains two RNA recognition motifs (RRM) at the N-terminus, and multiple hexapeptide repeat domain at the C-terminus that interacts with thyroid hormone receptor-binding protein (TRBP), and is required for transcription activation. Alternatively spliced transcript variants encoding different isoforms (with opposing effects on transcription) have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Aadat A G 8: 60,532,298 probably benign Het
Acsm5 T C 7: 119,528,426 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Cdr2 T G 7: 120,970,331 I62L possibly damaging Het
Clk3 T C 9: 57,754,619 I382V possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fam160b2 A G 14: 70,586,365 Y568H probably benign Het
Fxyd5 T C 7: 31,036,471 N104S probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Ift122 A G 6: 115,884,350 D193G probably damaging Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Olfr1477 A T 19: 13,502,508 H55L probably damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Polr3e C G 7: 120,942,564 D623E probably damaging Het
Rapgef6 T C 11: 54,694,272 Y1494H probably damaging Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Slc10a7 A G 8: 78,509,632 I20V probably damaging Het
Sort1 C T 3: 108,346,665 T549I possibly damaging Het
Stambpl1 G A 19: 34,236,354 V328I probably benign Het
Thbd A G 2: 148,406,364 L528P probably damaging Het
Wbp11 A T 6: 136,824,332 M63K probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Rbm14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Rbm14 APN 19 4802548 intron probably benign
IGL00430:Rbm14 APN 19 4811426 missense probably damaging 1.00
IGL02226:Rbm14 APN 19 4801717 unclassified probably benign
R1732:Rbm14 UTSW 19 4803467 missense probably benign 0.03
R1840:Rbm14 UTSW 19 4801795 intron probably benign
R2044:Rbm14 UTSW 19 4803877 missense possibly damaging 0.90
R4656:Rbm14 UTSW 19 4811435 missense probably damaging 1.00
R4771:Rbm14 UTSW 19 4802643 intron probably benign
R5081:Rbm14 UTSW 19 4802795 missense probably benign 0.23
R5729:Rbm14 UTSW 19 4802549 intron probably benign
R6432:Rbm14 UTSW 19 4803163 intron probably benign
R6905:Rbm14 UTSW 19 4803236 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGATAACCTGGGTCTGCACC -3'
(R):5'- ACCAACTGTTTGAGACAAATCTGG -3'

Sequencing Primer
(F):5'- GGTCTGCACCCTACCCTAC -3'
(R):5'- TTGAGACAAATCTGGTATACCCTCC -3'
Posted On2014-10-30