Incidental Mutation 'R2362:Olfr1477'
ID 247200
Institutional Source Beutler Lab
Gene Symbol Olfr1477
Ensembl Gene ENSMUSG00000071629
Gene Name olfactory receptor 1477
Synonyms MOR202-10, GA_x6K02T2RE5P-3834960-3835907
MMRRC Submission 040343-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R2362 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 13500546-13506192 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13502508 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 55 (H55L)
Ref Sequence ENSEMBL: ENSMUSP00000149565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096201] [ENSMUST00000214274] [ENSMUST00000217001]
AlphaFold Q7TQQ7
Predicted Effect probably damaging
Transcript: ENSMUST00000096201
AA Change: H55L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093915
Gene: ENSMUSG00000095189
AA Change: H55L

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 3.9e-53 PFAM
Pfam:7TM_GPCR_Srsx 34 304 2.6e-6 PFAM
Pfam:7tm_1 40 289 1.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208393
Predicted Effect probably damaging
Transcript: ENSMUST00000214274
AA Change: H55L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217001
AA Change: H55L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A T 6: 132,627,479 M1K probably null Het
Aadat A G 8: 60,532,298 probably benign Het
Acsm5 T C 7: 119,528,426 probably benign Het
Avl9 A T 6: 56,736,570 N271I probably benign Het
Ccdc30 T A 4: 119,324,056 N636I probably damaging Het
Cdr2 T G 7: 120,970,331 I62L possibly damaging Het
Clk3 T C 9: 57,754,619 I382V possibly damaging Het
Ctsr T A 13: 61,162,796 E45V probably damaging Het
Cyp2b19 A G 7: 26,764,377 Y318C probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dapk1 A G 13: 60,730,931 N578S probably damaging Het
Dlg5 A T 14: 24,158,687 M817K probably benign Het
Dtx4 A G 19: 12,492,535 V76A probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Fam160b2 A G 14: 70,586,365 Y568H probably benign Het
Fxyd5 T C 7: 31,036,471 N104S probably benign Het
Gm5155 T G 7: 17,902,473 noncoding transcript Het
Ift122 A G 6: 115,884,350 D193G probably damaging Het
Lrrcc1 A G 3: 14,563,024 E542G probably damaging Het
Macc1 T C 12: 119,447,658 probably benign Het
Ndst3 T A 3: 123,552,678 Y234F possibly damaging Het
Pes1 T C 11: 3,977,123 F429S probably damaging Het
Polr3e C G 7: 120,942,564 D623E probably damaging Het
Rapgef6 T C 11: 54,694,272 Y1494H probably damaging Het
Rbm14 T C 19: 4,801,707 probably benign Het
Rnf103 A G 6: 71,510,017 D544G probably benign Het
Slc10a7 A G 8: 78,509,632 I20V probably damaging Het
Sort1 C T 3: 108,346,665 T549I possibly damaging Het
Stambpl1 G A 19: 34,236,354 V328I probably benign Het
Thbd A G 2: 148,406,364 L528P probably damaging Het
Wbp11 A T 6: 136,824,332 M63K probably damaging Het
Wdr11 T A 7: 129,634,836 I1178N probably benign Het
Other mutations in Olfr1477
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01926:Olfr1477 APN 19 13502741 missense possibly damaging 0.55
IGL02394:Olfr1477 APN 19 13502864 missense probably damaging 0.97
R0047:Olfr1477 UTSW 19 13502589 missense probably benign 0.30
R0047:Olfr1477 UTSW 19 13502589 missense probably benign 0.30
R0356:Olfr1477 UTSW 19 13503077 missense possibly damaging 0.74
R0617:Olfr1477 UTSW 19 13502536 missense probably damaging 1.00
R1589:Olfr1477 UTSW 19 13502757 missense probably benign 0.03
R1725:Olfr1477 UTSW 19 13502519 missense probably damaging 1.00
R2153:Olfr1477 UTSW 19 13502488 missense probably damaging 1.00
R3402:Olfr1477 UTSW 19 13502948 missense probably benign 0.11
R4513:Olfr1477 UTSW 19 13502622 missense probably benign 0.05
R5197:Olfr1477 UTSW 19 13502384 missense possibly damaging 0.68
R5205:Olfr1477 UTSW 19 13502799 missense probably damaging 1.00
R5511:Olfr1477 UTSW 19 13503192 missense probably benign 0.12
R5838:Olfr1477 UTSW 19 13502558 missense probably damaging 1.00
R6023:Olfr1477 UTSW 19 13502703 missense probably damaging 1.00
R6232:Olfr1477 UTSW 19 13503063 missense probably damaging 1.00
R6700:Olfr1477 UTSW 19 13502813 missense probably damaging 0.97
R6769:Olfr1477 UTSW 19 13502954 missense possibly damaging 0.83
R6771:Olfr1477 UTSW 19 13502954 missense possibly damaging 0.83
R7002:Olfr1477 UTSW 19 13502675 missense probably benign 0.00
R7057:Olfr1477 UTSW 19 13502879 missense probably damaging 1.00
R7320:Olfr1477 UTSW 19 13503180 missense possibly damaging 0.89
R7827:Olfr1477 UTSW 19 13503223 missense probably damaging 1.00
R7913:Olfr1477 UTSW 19 13503207 missense probably damaging 1.00
R9199:Olfr1477 UTSW 19 13503072 missense probably damaging 1.00
R9286:Olfr1477 UTSW 19 13502427 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATCGCTTGCTGATGTCCAAATAC -3'
(R):5'- ATTGAGGCCAGGATAAAATTCTCAG -3'

Sequencing Primer
(F):5'- GCACCATTCCTGCAAACT -3'
(R):5'- GCCAGGATAAAATTCTCAGTAATAGC -3'
Posted On 2014-10-30