Mutagenetix > Incidental Mutation

Incidental Mutation 'R2363:Abtb2'

247208

Institutional Source

Beutler Lab

Gene Symbol

Abtb2

Ensembl Gene

ENSMUSG00000032724

Gene Name

ankyrin repeat and BTB (POZ) domain containing 2

Synonyms

MMRRC Submission

040344-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2363 (G1)

Quality Score

173

Status

Validated

Chromosome

Chromosomal Location

103566310-103718423 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103567183 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 153 (C153R)

Ref Sequence

ENSEMBL: ENSMUSP00000075566 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076212]

AlphaFold

Q7TQI7

Predicted Effect

probably damaging
Transcript: ENSMUST00000076212
AA Change: C153R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: C153R

Domain	Start	End	E-Value	Type
low complexity region	29	48	N/A	INTRINSIC
low complexity region	122	143	N/A	INTRINSIC
Blast:H2A	186	301	2e-38	BLAST
low complexity region	366	376	N/A	INTRINSIC
ANK	521	550	4.78e-7	SMART
ANK	567	596	6.26e-2	SMART
ANK	606	635	3.65e-3	SMART
ANK	649	678	5.52e2	SMART
ANK	715	746	1.84e3	SMART
BTB	844	946	9.15e-24	SMART

Meta Mutation Damage Score

0.8970

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

98% (51/52)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	A	G	1: 63,557,491		probably null	Het
Adpgk	G	T	9: 59,314,853	M354I	probably benign	Het
Atmin	G	T	8: 116,954,914		probably null	Het
C1rl	G	A	6: 124,509,110	G480D	probably benign	Het
C4b	G	A	17: 34,736,058		probably benign	Het
Cacnb1	G	A	11: 98,012,846	T127I	possibly damaging	Het
Cmya5	A	T	13: 93,093,702	V1626E	probably benign	Het
Cndp2	C	T	18: 84,668,569	G443S	probably damaging	Het
Crb1	A	G	1: 139,337,278	I134T	possibly damaging	Het
Dnaaf3	T	C	7: 4,532,277		probably null	Het
Enam	C	T	5: 88,503,149	P764L	probably benign	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fbln1	G	A	15: 85,227,140		probably null	Het
Flnb	A	G	14: 7,945,950	I2452V	possibly damaging	Het
Fmo3	A	T	1: 162,954,315	W490R	probably damaging	Het
Gabrb1	C	T	5: 71,869,573	R106*	probably null	Het
Galnt4	C	T	10: 99,109,061	T216I	probably damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Golph3	A	G	15: 12,349,563	D223G	probably benign	Het
Herc4	T	A	10: 63,315,694	F905I	possibly damaging	Het
Il23r	T	C	6: 67,452,417	T314A	probably benign	Het
Lrrtm4	T	C	6: 80,021,874	W90R	probably damaging	Het
Maml2	C	T	9: 13,621,245	T585I	probably damaging	Het
Mpp3	G	A	11: 102,020,486	A170V	probably damaging	Het
Naip6	T	A	13: 100,316,420	K44N	possibly damaging	Het
Olfr1301	C	T	2: 111,754,794	P182S	probably damaging	Het
Olfr1328	C	T	4: 118,934,033	E272K	probably benign	Het
Olfr23	A	G	11: 73,940,356	T37A	possibly damaging	Het
Olfr250	T	C	9: 38,368,098	I174T	probably damaging	Het
Olfr432	C	T	1: 174,051,248	R292C	probably damaging	Het
Olfr523	A	G	7: 140,176,965	T282A	probably damaging	Het
Olfr58	T	G	9: 19,783,596	I154M	probably benign	Het
Olfr65	T	A	7: 103,907,060	M207K	probably benign	Het
Pak1	T	A	7: 97,886,314	V204E	probably benign	Het
Pcdhb10	T	A	18: 37,414,137	C755*	probably null	Het
Pcdhb20	A	G	18: 37,505,672	Y417C	probably damaging	Het
Pkd1l3	G	T	8: 109,628,709	W723L	probably benign	Het
Plin1	C	T	7: 79,726,391		probably null	Het
Polr3a	A	T	14: 24,475,892		probably null	Het
Ranbp2	A	T	10: 58,478,936	K1826I	possibly damaging	Het
Rapgef1	A	G	2: 29,736,596	I970V	possibly damaging	Het
Rdx	C	A	9: 52,068,873	F255L	probably damaging	Het
Rp1l1	A	T	14: 64,029,998	H1011L	possibly damaging	Het
Serpina6	T	C	12: 103,648,609	D326G	probably benign	Het
Sh3tc2	A	G	18: 61,990,895	E909G	probably benign	Het
Shprh	T	A	10: 11,171,953	V1015D	probably damaging	Het
Slfn8	A	T	11: 83,004,094	Y629N	probably damaging	Het
Triml1	A	G	8: 43,141,371	S8P	probably damaging	Het

Other mutations in Abtb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01161:Abtb2	APN	2	103705118	missense	probably benign	0.00
IGL02605:Abtb2	APN	2	103717257	missense	probably benign
IGL03161:Abtb2	APN	2	103567454	missense	probably benign	0.02
PIT4504001:Abtb2	UTSW	2	103717192	nonsense	probably null
R0147:Abtb2	UTSW	2	103567135	missense	probably benign	0.04
R1052:Abtb2	UTSW	2	103705072	missense	possibly damaging	0.46
R1419:Abtb2	UTSW	2	103709420	missense	probably benign	0.00
R1518:Abtb2	UTSW	2	103709284	missense	probably benign	0.03
R1650:Abtb2	UTSW	2	103702402	missense	probably damaging	1.00
R1795:Abtb2	UTSW	2	103567024	missense	probably benign	0.00
R2054:Abtb2	UTSW	2	103705117	missense	probably benign	0.41
R2101:Abtb2	UTSW	2	103566862	missense	probably benign	0.05
R3440:Abtb2	UTSW	2	103567232	missense	probably benign	0.43
R3927:Abtb2	UTSW	2	103708218	splice site	probably null
R4351:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4352:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4782:Abtb2	UTSW	2	103717299	missense	probably benign	0.35
R4814:Abtb2	UTSW	2	103717287	missense	probably benign	0.08
R4831:Abtb2	UTSW	2	103683475	missense	probably benign	0.06
R4900:Abtb2	UTSW	2	103567004	missense	possibly damaging	0.62
R5038:Abtb2	UTSW	2	103567063	missense	probably damaging	0.99
R5513:Abtb2	UTSW	2	103709278	critical splice acceptor site	probably null
R6119:Abtb2	UTSW	2	103702310	missense	probably benign	0.00
R6298:Abtb2	UTSW	2	103709488	missense	probably benign	0.10
R6383:Abtb2	UTSW	2	103567376	missense	probably damaging	0.98
R6860:Abtb2	UTSW	2	103709425	nonsense	probably null
R7000:Abtb2	UTSW	2	103712442	missense	possibly damaging	0.85
R7109:Abtb2	UTSW	2	103715515	missense	probably benign	0.20
R7176:Abtb2	UTSW	2	103709375	missense	probably benign	0.00
R7189:Abtb2	UTSW	2	103567516	missense	probably benign	0.00
R7199:Abtb2	UTSW	2	103567220	missense	possibly damaging	0.74
R7299:Abtb2	UTSW	2	103702424	splice site	probably null
R7347:Abtb2	UTSW	2	103567412	missense	probably damaging	1.00
R7469:Abtb2	UTSW	2	103566947	missense	probably benign	0.00
R7629:Abtb2	UTSW	2	103683493	critical splice donor site	probably null
R7862:Abtb2	UTSW	2	103702281	missense	probably damaging	1.00
R8200:Abtb2	UTSW	2	103700817	missense	probably benign	0.02
R8682:Abtb2	UTSW	2	103567375	missense	probably benign	0.36
R8700:Abtb2	UTSW	2	103566944	missense	probably damaging	0.99
R9164:Abtb2	UTSW	2	103711484	missense	possibly damaging	0.50
R9196:Abtb2	UTSW	2	103683302	missense	possibly damaging	0.71
R9254:Abtb2	UTSW	2	103711235	missense	probably benign	0.00
R9258:Abtb2	UTSW	2	103716065	missense	probably null	0.99
R9343:Abtb2	UTSW	2	103717160	missense	probably benign
R9427:Abtb2	UTSW	2	103700899	missense	probably damaging	1.00
R9675:Abtb2	UTSW	2	103708187	missense	probably benign
Z1176:Abtb2	UTSW	2	103708172	nonsense	probably null
Z1177:Abtb2	UTSW	2	103711196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTCCGGCTCCATGAACAG -3'
(R):5'- ACCAGGTTCTCCATGCAAGC -3'

Sequencing Primer
(F):5'- CACGGTGAACACAGTGCTG -3'
(R):5'- GGTTCTCCATGCAAGCCGTTAG -3'

Posted On

2014-10-30