Incidental Mutation 'R2363:Olfr1328'
ID 247212
Institutional Source Beutler Lab
Gene Symbol Olfr1328
Ensembl Gene ENSMUSG00000111259
Gene Name olfactory receptor 1328
Synonyms Olfr1519, MOR259-1, MOR259-13, MOR259-1, GA_x6K02T2QD9B-18602750-18603691
MMRRC Submission 040344-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R2363 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 118930071-118938612 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 118934033 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 272 (E272K)
Ref Sequence ENSEMBL: ENSMUSP00000149039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081960] [ENSMUST00000215312]
AlphaFold A0A1L1SQF6
Predicted Effect probably benign
Transcript: ENSMUST00000081960
AA Change: E270K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000080626
Gene: ENSMUSG00000111259
AA Change: E270K

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 36 306 9.1e-8 PFAM
Pfam:7tm_1 42 291 1.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215312
AA Change: E272K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.1555 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T C 2: 103,567,183 C153R probably damaging Het
Adam23 A G 1: 63,557,491 probably null Het
Adpgk G T 9: 59,314,853 M354I probably benign Het
Atmin G T 8: 116,954,914 probably null Het
C1rl G A 6: 124,509,110 G480D probably benign Het
C4b G A 17: 34,736,058 probably benign Het
Cacnb1 G A 11: 98,012,846 T127I possibly damaging Het
Cmya5 A T 13: 93,093,702 V1626E probably benign Het
Cndp2 C T 18: 84,668,569 G443S probably damaging Het
Crb1 A G 1: 139,337,278 I134T possibly damaging Het
Dnaaf3 T C 7: 4,532,277 probably null Het
Enam C T 5: 88,503,149 P764L probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbln1 G A 15: 85,227,140 probably null Het
Flnb A G 14: 7,945,950 I2452V possibly damaging Het
Fmo3 A T 1: 162,954,315 W490R probably damaging Het
Gabrb1 C T 5: 71,869,573 R106* probably null Het
Galnt4 C T 10: 99,109,061 T216I probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Golph3 A G 15: 12,349,563 D223G probably benign Het
Herc4 T A 10: 63,315,694 F905I possibly damaging Het
Il23r T C 6: 67,452,417 T314A probably benign Het
Lrrtm4 T C 6: 80,021,874 W90R probably damaging Het
Maml2 C T 9: 13,621,245 T585I probably damaging Het
Mpp3 G A 11: 102,020,486 A170V probably damaging Het
Naip6 T A 13: 100,316,420 K44N possibly damaging Het
Olfr1301 C T 2: 111,754,794 P182S probably damaging Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr250 T C 9: 38,368,098 I174T probably damaging Het
Olfr432 C T 1: 174,051,248 R292C probably damaging Het
Olfr523 A G 7: 140,176,965 T282A probably damaging Het
Olfr58 T G 9: 19,783,596 I154M probably benign Het
Olfr65 T A 7: 103,907,060 M207K probably benign Het
Pak1 T A 7: 97,886,314 V204E probably benign Het
Pcdhb10 T A 18: 37,414,137 C755* probably null Het
Pcdhb20 A G 18: 37,505,672 Y417C probably damaging Het
Pkd1l3 G T 8: 109,628,709 W723L probably benign Het
Plin1 C T 7: 79,726,391 probably null Het
Polr3a A T 14: 24,475,892 probably null Het
Ranbp2 A T 10: 58,478,936 K1826I possibly damaging Het
Rapgef1 A G 2: 29,736,596 I970V possibly damaging Het
Rdx C A 9: 52,068,873 F255L probably damaging Het
Rp1l1 A T 14: 64,029,998 H1011L possibly damaging Het
Serpina6 T C 12: 103,648,609 D326G probably benign Het
Sh3tc2 A G 18: 61,990,895 E909G probably benign Het
Shprh T A 10: 11,171,953 V1015D probably damaging Het
Slfn8 A T 11: 83,004,094 Y629N probably damaging Het
Triml1 A G 8: 43,141,371 S8P probably damaging Het
Other mutations in Olfr1328
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Olfr1328 APN 4 118934161 missense probably damaging 1.00
IGL02685:Olfr1328 APN 4 118933937 missense possibly damaging 0.61
IGL02886:Olfr1328 APN 4 118934830 missense probably benign
IGL02899:Olfr1328 APN 4 118934662 missense probably damaging 1.00
IGL02957:Olfr1328 APN 4 118934119 missense probably damaging 1.00
PIT4453001:Olfr1328 UTSW 4 118934626 missense probably benign
R0211:Olfr1328 UTSW 4 118934270 missense probably benign 0.00
R0211:Olfr1328 UTSW 4 118934270 missense probably benign 0.00
R1158:Olfr1328 UTSW 4 118934417 missense probably damaging 1.00
R1450:Olfr1328 UTSW 4 118934510 missense probably benign 0.01
R1682:Olfr1328 UTSW 4 118934581 missense probably damaging 1.00
R1978:Olfr1328 UTSW 4 118934184 nonsense probably null
R2364:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R2365:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R2507:Olfr1328 UTSW 4 118933925 missense probably benign
R2912:Olfr1328 UTSW 4 118934701 missense probably benign 0.28
R3937:Olfr1328 UTSW 4 118934683 missense probably damaging 1.00
R4058:Olfr1328 UTSW 4 118934683 missense probably damaging 1.00
R4089:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R4090:Olfr1328 UTSW 4 118934033 missense probably benign 0.02
R4419:Olfr1328 UTSW 4 118934389 missense possibly damaging 0.56
R4717:Olfr1328 UTSW 4 118934429 missense probably benign 0.45
R5570:Olfr1328 UTSW 4 118934066 missense possibly damaging 0.88
R5591:Olfr1328 UTSW 4 118934461 missense probably damaging 1.00
R6149:Olfr1328 UTSW 4 118934431 missense probably damaging 1.00
R7202:Olfr1328 UTSW 4 118934018 missense probably benign
R7214:Olfr1328 UTSW 4 118933949 missense possibly damaging 0.88
R7391:Olfr1328 UTSW 4 118934001 missense possibly damaging 0.61
R7666:Olfr1328 UTSW 4 118934264 missense probably damaging 1.00
R7676:Olfr1328 UTSW 4 118934150 missense probably damaging 1.00
R8053:Olfr1328 UTSW 4 118934111 missense probably damaging 1.00
R8311:Olfr1328 UTSW 4 118934150 missense probably damaging 0.97
R9540:Olfr1328 UTSW 4 118934837 missense probably benign
Z1176:Olfr1328 UTSW 4 118933918 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGGTTCAAATGCACAGATCAACTTC -3'
(R):5'- ACCCACCTCATTGAGATGGTG -3'

Sequencing Primer
(F):5'- AGACACTGAACTTTTCTTAAAGAGTG -3'
(R):5'- CACCTCATTGAGATGGTGGACTTTG -3'
Posted On 2014-10-30