Incidental Mutation 'R2363:Gabrb1'
ID 247213
Institutional Source Beutler Lab
Gene Symbol Gabrb1
Ensembl Gene ENSMUSG00000029212
Gene Name gamma-aminobutyric acid type A receptor subunit beta 1
Synonyms Gabrb-1, B230208N19Rik
MMRRC Submission 040344-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2363 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 71815456-72306380 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 72026916 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 106 (R106*)
Ref Sequence ENSEMBL: ENSMUSP00000143682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031122] [ENSMUST00000199967]
AlphaFold P50571
Predicted Effect probably null
Transcript: ENSMUST00000031122
AA Change: R139*
SMART Domains Protein: ENSMUSP00000031122
Gene: ENSMUSG00000029212
AA Change: R139*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 7.1e-52 PFAM
Pfam:Neur_chan_memb 250 469 2.4e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199967
AA Change: R106*
SMART Domains Protein: ENSMUSP00000143682
Gene: ENSMUSG00000029212
AA Change: R106*

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 4 210 4.8e-51 PFAM
Meta Mutation Damage Score 0.9718 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 1 subunit. It is mapped to chromosome 4p12 in a cluster comprised of genes encoding alpha 4, alpha 2 and gamma 1 subunits of the GABA A receptor. Alteration of this gene is implicated in the pathogenetics of schizophrenia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for an ENU or spontaneous mutation exhibit alcohol preference with increased tonic inhibition, female infertility and hypothalamic pituitary axis dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T C 2: 103,397,528 (GRCm39) C153R probably damaging Het
Adam23 A G 1: 63,596,650 (GRCm39) probably null Het
Adpgk G T 9: 59,222,136 (GRCm39) M354I probably benign Het
Atmin G T 8: 117,681,653 (GRCm39) probably null Het
C1rl G A 6: 124,486,069 (GRCm39) G480D probably benign Het
C4b G A 17: 34,955,032 (GRCm39) probably benign Het
Cacnb1 G A 11: 97,903,672 (GRCm39) T127I possibly damaging Het
Cmya5 A T 13: 93,230,210 (GRCm39) V1626E probably benign Het
Cndp2 C T 18: 84,686,694 (GRCm39) G443S probably damaging Het
Crb1 A G 1: 139,265,016 (GRCm39) I134T possibly damaging Het
Dnaaf3 T C 7: 4,535,276 (GRCm39) probably null Het
Enam C T 5: 88,651,008 (GRCm39) P764L probably benign Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Fbln1 G A 15: 85,111,341 (GRCm39) probably null Het
Flnb A G 14: 7,945,950 (GRCm38) I2452V possibly damaging Het
Fmo3 A T 1: 162,781,884 (GRCm39) W490R probably damaging Het
Galnt4 C T 10: 98,944,923 (GRCm39) T216I probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Golph3 A G 15: 12,349,649 (GRCm39) D223G probably benign Het
Herc4 T A 10: 63,151,473 (GRCm39) F905I possibly damaging Het
Il23r T C 6: 67,429,401 (GRCm39) T314A probably benign Het
Lrrtm4 T C 6: 79,998,857 (GRCm39) W90R probably damaging Het
Maml2 C T 9: 13,532,541 (GRCm39) T585I probably damaging Het
Mpp3 G A 11: 101,911,312 (GRCm39) A170V probably damaging Het
Naip6 T A 13: 100,452,928 (GRCm39) K44N possibly damaging Het
Or10aa3 C T 1: 173,878,814 (GRCm39) R292C probably damaging Het
Or10ak7 C T 4: 118,791,230 (GRCm39) E272K probably benign Het
Or1e17 A G 11: 73,831,182 (GRCm39) T37A possibly damaging Het
Or4k51 C T 2: 111,585,139 (GRCm39) P182S probably damaging Het
Or51b6 T A 7: 103,556,267 (GRCm39) M207K probably benign Het
Or6f2 A G 7: 139,756,878 (GRCm39) T282A probably damaging Het
Or7e165 T G 9: 19,694,892 (GRCm39) I154M probably benign Het
Or8c10 T C 9: 38,279,394 (GRCm39) I174T probably damaging Het
Pak1 T A 7: 97,535,521 (GRCm39) V204E probably benign Het
Pcdhb10 T A 18: 37,547,190 (GRCm39) C755* probably null Het
Pcdhb20 A G 18: 37,638,725 (GRCm39) Y417C probably damaging Het
Pkd1l3 G T 8: 110,355,341 (GRCm39) W723L probably benign Het
Plin1 C T 7: 79,376,139 (GRCm39) probably null Het
Polr3a A T 14: 24,525,960 (GRCm39) probably null Het
Ranbp2 A T 10: 58,314,758 (GRCm39) K1826I possibly damaging Het
Rapgef1 A G 2: 29,626,608 (GRCm39) I970V possibly damaging Het
Rdx C A 9: 51,980,173 (GRCm39) F255L probably damaging Het
Rp1l1 A T 14: 64,267,447 (GRCm39) H1011L possibly damaging Het
Serpina6 T C 12: 103,614,868 (GRCm39) D326G probably benign Het
Sh3tc2 A G 18: 62,123,966 (GRCm39) E909G probably benign Het
Shprh T A 10: 11,047,697 (GRCm39) V1015D probably damaging Het
Slfn8 A T 11: 82,894,920 (GRCm39) Y629N probably damaging Het
Triml1 A G 8: 43,594,408 (GRCm39) S8P probably damaging Het
Other mutations in Gabrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Gabrb1 APN 5 72,265,789 (GRCm39) critical splice donor site probably null
IGL00774:Gabrb1 APN 5 72,265,789 (GRCm39) critical splice donor site probably null
IGL01534:Gabrb1 APN 5 72,026,772 (GRCm39) missense possibly damaging 0.95
IGL02170:Gabrb1 APN 5 72,294,073 (GRCm39) missense probably damaging 1.00
IGL02326:Gabrb1 APN 5 71,858,190 (GRCm39) missense probably damaging 0.99
IGL03278:Gabrb1 APN 5 72,026,939 (GRCm39) missense probably damaging 1.00
IGL03345:Gabrb1 APN 5 72,293,908 (GRCm39) missense possibly damaging 0.53
IGL03050:Gabrb1 UTSW 5 72,279,497 (GRCm39) missense probably benign 0.03
PIT4445001:Gabrb1 UTSW 5 72,266,125 (GRCm39) missense probably damaging 1.00
PIT4515001:Gabrb1 UTSW 5 71,858,160 (GRCm39) missense probably damaging 1.00
R0109:Gabrb1 UTSW 5 72,279,289 (GRCm39) splice site probably benign
R0386:Gabrb1 UTSW 5 72,266,150 (GRCm39) missense probably damaging 0.99
R1512:Gabrb1 UTSW 5 72,266,048 (GRCm39) missense probably damaging 1.00
R1512:Gabrb1 UTSW 5 72,266,047 (GRCm39) missense probably damaging 1.00
R1717:Gabrb1 UTSW 5 72,265,694 (GRCm39) splice site probably null
R1832:Gabrb1 UTSW 5 72,279,281 (GRCm39) splice site probably null
R1961:Gabrb1 UTSW 5 71,857,679 (GRCm39) missense probably benign 0.28
R4686:Gabrb1 UTSW 5 71,857,365 (GRCm39) missense possibly damaging 0.53
R4840:Gabrb1 UTSW 5 71,858,154 (GRCm39) missense probably damaging 1.00
R4916:Gabrb1 UTSW 5 72,026,764 (GRCm39) missense probably damaging 1.00
R4941:Gabrb1 UTSW 5 72,294,121 (GRCm39) missense probably damaging 1.00
R5250:Gabrb1 UTSW 5 72,026,922 (GRCm39) missense possibly damaging 0.80
R5270:Gabrb1 UTSW 5 72,265,669 (GRCm39) missense probably damaging 1.00
R5364:Gabrb1 UTSW 5 72,294,105 (GRCm39) missense probably benign 0.33
R5407:Gabrb1 UTSW 5 72,279,364 (GRCm39) missense possibly damaging 0.90
R5621:Gabrb1 UTSW 5 72,266,071 (GRCm39) missense probably damaging 1.00
R5790:Gabrb1 UTSW 5 72,293,827 (GRCm39) missense possibly damaging 0.53
R6236:Gabrb1 UTSW 5 72,265,663 (GRCm39) missense probably damaging 1.00
R6336:Gabrb1 UTSW 5 72,187,241 (GRCm39) missense possibly damaging 0.72
R7411:Gabrb1 UTSW 5 72,279,538 (GRCm39) critical splice donor site probably null
R8375:Gabrb1 UTSW 5 72,187,172 (GRCm39) missense probably damaging 0.98
R9161:Gabrb1 UTSW 5 72,187,199 (GRCm39) missense probably damaging 0.98
R9474:Gabrb1 UTSW 5 72,265,690 (GRCm39) missense probably damaging 1.00
R9621:Gabrb1 UTSW 5 72,279,363 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACACTCACCATGTATTTCCAGC -3'
(R):5'- GTCACCTACACTTGATGGGCAG -3'

Sequencing Primer
(F):5'- ATTTCCAGCAGTCTTGGAAGGAC -3'
(R):5'- ACCTACACTTGATGGGCAGTTGTC -3'
Posted On 2014-10-30