Incidental Mutation 'R2363:Enam'
ID247214
Institutional Source Beutler Lab
Gene Symbol Enam
Ensembl Gene ENSMUSG00000029286
Gene Nameenamelin
Synonymsabte
MMRRC Submission 040344-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.672) question?
Stock #R2363 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location88487975-88506049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88503149 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 764 (P764L)
Ref Sequence ENSEMBL: ENSMUSP00000031222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]
Predicted Effect probably benign
Transcript: ENSMUST00000031222
AA Change: P764L

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: P764L

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 67 114 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
Pfam:Enamelin 216 441 5.4e-74 PFAM
Pfam:Enamelin 503 1249 1.9e-303 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199104
AA Change: P839L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: P839L

DomainStartEndE-ValueType
low complexity region 100 113 N/A INTRINSIC
low complexity region 142 189 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
low complexity region 234 242 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
Pfam:Enamelin 291 510 2.5e-74 PFAM
Pfam:Enamelin 550 1325 N/A PFAM
Meta Mutation Damage Score 0.2122 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T C 2: 103,567,183 C153R probably damaging Het
Adam23 A G 1: 63,557,491 probably null Het
Adpgk G T 9: 59,314,853 M354I probably benign Het
Atmin G T 8: 116,954,914 probably null Het
C1rl G A 6: 124,509,110 G480D probably benign Het
C4b G A 17: 34,736,058 probably benign Het
Cacnb1 G A 11: 98,012,846 T127I possibly damaging Het
Cmya5 A T 13: 93,093,702 V1626E probably benign Het
Cndp2 C T 18: 84,668,569 G443S probably damaging Het
Crb1 A G 1: 139,337,278 I134T possibly damaging Het
Dnaaf3 T C 7: 4,532,277 probably null Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbln1 G A 15: 85,227,140 probably null Het
Flnb A G 14: 7,945,950 I2452V possibly damaging Het
Fmo3 A T 1: 162,954,315 W490R probably damaging Het
Gabrb1 C T 5: 71,869,573 R106* probably null Het
Galnt4 C T 10: 99,109,061 T216I probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Golph3 A G 15: 12,349,563 D223G probably benign Het
Herc4 T A 10: 63,315,694 F905I possibly damaging Het
Il23r T C 6: 67,452,417 T314A probably benign Het
Lrrtm4 T C 6: 80,021,874 W90R probably damaging Het
Maml2 C T 9: 13,621,245 T585I probably damaging Het
Mpp3 G A 11: 102,020,486 A170V probably damaging Het
Naip6 T A 13: 100,316,420 K44N possibly damaging Het
Olfr1301 C T 2: 111,754,794 P182S probably damaging Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr250 T C 9: 38,368,098 I174T probably damaging Het
Olfr432 C T 1: 174,051,248 R292C probably damaging Het
Olfr523 A G 7: 140,176,965 T282A probably damaging Het
Olfr58 T G 9: 19,783,596 I154M probably benign Het
Olfr65 T A 7: 103,907,060 M207K probably benign Het
Pak1 T A 7: 97,886,314 V204E probably benign Het
Pcdhb10 T A 18: 37,414,137 C755* probably null Het
Pcdhb20 A G 18: 37,505,672 Y417C probably damaging Het
Pkd1l3 G T 8: 109,628,709 W723L probably benign Het
Plin1 C T 7: 79,726,391 probably null Het
Polr3a A T 14: 24,475,892 probably null Het
Ranbp2 A T 10: 58,478,936 K1826I possibly damaging Het
Rapgef1 A G 2: 29,736,596 I970V possibly damaging Het
Rdx C A 9: 52,068,873 F255L probably damaging Het
Rp1l1 A T 14: 64,029,998 H1011L possibly damaging Het
Serpina6 T C 12: 103,648,609 D326G probably benign Het
Sh3tc2 A G 18: 61,990,895 E909G probably benign Het
Shprh T A 10: 11,171,953 V1015D probably damaging Het
Slfn8 A T 11: 83,004,094 Y629N probably damaging Het
Triml1 A G 8: 43,141,371 S8P probably damaging Het
Other mutations in Enam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Enam APN 5 88501484 missense possibly damaging 0.83
IGL01611:Enam APN 5 88503749 missense probably damaging 0.99
IGL01802:Enam APN 5 88503674 missense possibly damaging 0.93
IGL02220:Enam APN 5 88504559 nonsense probably null
IGL02371:Enam APN 5 88502809 missense probably benign 0.39
IGL02596:Enam APN 5 88503026 missense probably benign 0.01
IGL03026:Enam APN 5 88503299 missense probably benign 0.38
IGL03303:Enam APN 5 88504591 missense probably benign 0.12
opinionated UTSW 5 88503026 missense probably benign 0.04
recalcitrant UTSW 5 88503791 nonsense probably null
R0200:Enam UTSW 5 88493027 missense possibly damaging 0.96
R0230:Enam UTSW 5 88489655 splice site probably benign
R0395:Enam UTSW 5 88501508 missense probably damaging 0.99
R0548:Enam UTSW 5 88503105 missense probably damaging 0.96
R0608:Enam UTSW 5 88493027 missense possibly damaging 0.96
R0724:Enam UTSW 5 88501994 missense probably damaging 1.00
R0927:Enam UTSW 5 88494060 missense possibly damaging 0.72
R1023:Enam UTSW 5 88501967 missense probably damaging 0.99
R1053:Enam UTSW 5 88504019 missense possibly damaging 0.64
R1169:Enam UTSW 5 88503258 missense probably damaging 1.00
R1230:Enam UTSW 5 88494068 missense probably damaging 0.99
R1324:Enam UTSW 5 88494068 missense possibly damaging 0.53
R1663:Enam UTSW 5 88503994 missense probably damaging 1.00
R1727:Enam UTSW 5 88503994 missense probably damaging 1.00
R1750:Enam UTSW 5 88503227 missense probably damaging 1.00
R1852:Enam UTSW 5 88504465 missense possibly damaging 0.92
R1907:Enam UTSW 5 88504622 missense possibly damaging 0.86
R2104:Enam UTSW 5 88501787 missense probably damaging 1.00
R2143:Enam UTSW 5 88492920 missense probably benign 0.02
R2196:Enam UTSW 5 88502744 missense probably damaging 0.99
R2497:Enam UTSW 5 88502694 missense probably benign 0.13
R3615:Enam UTSW 5 88504447 missense possibly damaging 0.81
R3616:Enam UTSW 5 88504447 missense possibly damaging 0.81
R3782:Enam UTSW 5 88502815 missense probably damaging 1.00
R4067:Enam UTSW 5 88503377 missense probably damaging 1.00
R4349:Enam UTSW 5 88503548 missense probably damaging 0.99
R4604:Enam UTSW 5 88504283 missense possibly damaging 0.93
R4649:Enam UTSW 5 88492968 missense probably benign 0.02
R4702:Enam UTSW 5 88503791 nonsense probably null
R4703:Enam UTSW 5 88503791 nonsense probably null
R4704:Enam UTSW 5 88503791 nonsense probably null
R4705:Enam UTSW 5 88503791 nonsense probably null
R4714:Enam UTSW 5 88503536 missense probably damaging 1.00
R4748:Enam UTSW 5 88501543 missense probably damaging 1.00
R4838:Enam UTSW 5 88493108 nonsense probably null
R4840:Enam UTSW 5 88503026 missense probably benign 0.04
R4856:Enam UTSW 5 88488734 nonsense probably null
R4886:Enam UTSW 5 88488734 nonsense probably null
R4910:Enam UTSW 5 88502314 missense probably benign
R4911:Enam UTSW 5 88502314 missense probably benign
R6103:Enam UTSW 5 88502328 missense probably damaging 0.96
R6651:Enam UTSW 5 88502917 missense probably damaging 0.98
R6759:Enam UTSW 5 88501691 missense probably damaging 1.00
R7282:Enam UTSW 5 88502327 missense probably damaging 0.99
R7365:Enam UTSW 5 88501488 missense possibly damaging 0.75
R7392:Enam UTSW 5 88501664 missense probably damaging 0.99
R7483:Enam UTSW 5 88501820 missense probably damaging 1.00
R7647:Enam UTSW 5 88503025 missense probably benign 0.00
R7648:Enam UTSW 5 88504157 missense possibly damaging 0.89
R7672:Enam UTSW 5 88503971 missense possibly damaging 0.80
R7999:Enam UTSW 5 88503702 missense probably benign
X0018:Enam UTSW 5 88502691 nonsense probably null
Z1176:Enam UTSW 5 88492971 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAAGAAAACATTTCCCTGCTG -3'
(R):5'- CGTAGTGCTCACCTTCATACTG -3'

Sequencing Primer
(F):5'- TTCCCTGCTGAAAGAAATACCTGG -3'
(R):5'- TCATACTGCCTAACTGTTGGG -3'
Posted On2014-10-30