Mutagenetix > Incidental Mutation

Incidental Mutation 'R2363:Enam'

247214

Institutional Source

Beutler Lab

Gene Symbol

Enam

Ensembl Gene

ENSMUSG00000029286

Gene Name

enamelin

Synonyms

abte

MMRRC Submission

040344-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R2363 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88635834-88653908 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 88651008 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 764 (P764L)

Ref Sequence

ENSEMBL: ENSMUSP00000031222 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]

AlphaFold

O55196

Predicted Effect

probably benign
Transcript: ENSMUST00000031222
AA Change: P764L

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: P764L

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC
low complexity region	67	114	N/A	INTRINSIC
low complexity region	128	150	N/A	INTRINSIC
low complexity region	159	167	N/A	INTRINSIC
low complexity region	173	187	N/A	INTRINSIC
low complexity region	203	214	N/A	INTRINSIC
Pfam:Enamelin	216	441	5.4e-74	PFAM
Pfam:Enamelin	503	1249	1.9e-303	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199104
AA Change: P839L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: P839L

Domain	Start	End	E-Value	Type
low complexity region	100	113	N/A	INTRINSIC
low complexity region	142	189	N/A	INTRINSIC
low complexity region	203	225	N/A	INTRINSIC
low complexity region	234	242	N/A	INTRINSIC
low complexity region	248	262	N/A	INTRINSIC
low complexity region	278	289	N/A	INTRINSIC
Pfam:Enamelin	291	510	2.5e-74	PFAM
Pfam:Enamelin	550	1325	N/A	PFAM

Meta Mutation Damage Score

0.2122

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	T	C	2: 103,397,528 (GRCm39)	C153R	probably damaging	Het
Adam23	A	G	1: 63,596,650 (GRCm39)		probably null	Het
Adpgk	G	T	9: 59,222,136 (GRCm39)	M354I	probably benign	Het
Atmin	G	T	8: 117,681,653 (GRCm39)		probably null	Het
C1rl	G	A	6: 124,486,069 (GRCm39)	G480D	probably benign	Het
C4b	G	A	17: 34,955,032 (GRCm39)		probably benign	Het
Cacnb1	G	A	11: 97,903,672 (GRCm39)	T127I	possibly damaging	Het
Cmya5	A	T	13: 93,230,210 (GRCm39)	V1626E	probably benign	Het
Cndp2	C	T	18: 84,686,694 (GRCm39)	G443S	probably damaging	Het
Crb1	A	G	1: 139,265,016 (GRCm39)	I134T	possibly damaging	Het
Dnaaf3	T	C	7: 4,535,276 (GRCm39)		probably null	Het
Fat3	G	A	9: 15,909,567 (GRCm39)	S2145F	probably damaging	Het
Fbln1	G	A	15: 85,111,341 (GRCm39)		probably null	Het
Flnb	A	G	14: 7,945,950 (GRCm38)	I2452V	possibly damaging	Het
Fmo3	A	T	1: 162,781,884 (GRCm39)	W490R	probably damaging	Het
Gabrb1	C	T	5: 72,026,916 (GRCm39)	R106*	probably null	Het
Galnt4	C	T	10: 98,944,923 (GRCm39)	T216I	probably damaging	Het
Gkn3	C	T	6: 87,360,507 (GRCm39)	A163T	probably damaging	Het
Golph3	A	G	15: 12,349,649 (GRCm39)	D223G	probably benign	Het
Herc4	T	A	10: 63,151,473 (GRCm39)	F905I	possibly damaging	Het
Il23r	T	C	6: 67,429,401 (GRCm39)	T314A	probably benign	Het
Lrrtm4	T	C	6: 79,998,857 (GRCm39)	W90R	probably damaging	Het
Maml2	C	T	9: 13,532,541 (GRCm39)	T585I	probably damaging	Het
Mpp3	G	A	11: 101,911,312 (GRCm39)	A170V	probably damaging	Het
Naip6	T	A	13: 100,452,928 (GRCm39)	K44N	possibly damaging	Het
Or10aa3	C	T	1: 173,878,814 (GRCm39)	R292C	probably damaging	Het
Or10ak7	C	T	4: 118,791,230 (GRCm39)	E272K	probably benign	Het
Or1e17	A	G	11: 73,831,182 (GRCm39)	T37A	possibly damaging	Het
Or4k51	C	T	2: 111,585,139 (GRCm39)	P182S	probably damaging	Het
Or51b6	T	A	7: 103,556,267 (GRCm39)	M207K	probably benign	Het
Or6f2	A	G	7: 139,756,878 (GRCm39)	T282A	probably damaging	Het
Or7e165	T	G	9: 19,694,892 (GRCm39)	I154M	probably benign	Het
Or8c10	T	C	9: 38,279,394 (GRCm39)	I174T	probably damaging	Het
Pak1	T	A	7: 97,535,521 (GRCm39)	V204E	probably benign	Het
Pcdhb10	T	A	18: 37,547,190 (GRCm39)	C755*	probably null	Het
Pcdhb20	A	G	18: 37,638,725 (GRCm39)	Y417C	probably damaging	Het
Pkd1l3	G	T	8: 110,355,341 (GRCm39)	W723L	probably benign	Het
Plin1	C	T	7: 79,376,139 (GRCm39)		probably null	Het
Polr3a	A	T	14: 24,525,960 (GRCm39)		probably null	Het
Ranbp2	A	T	10: 58,314,758 (GRCm39)	K1826I	possibly damaging	Het
Rapgef1	A	G	2: 29,626,608 (GRCm39)	I970V	possibly damaging	Het
Rdx	C	A	9: 51,980,173 (GRCm39)	F255L	probably damaging	Het
Rp1l1	A	T	14: 64,267,447 (GRCm39)	H1011L	possibly damaging	Het
Serpina6	T	C	12: 103,614,868 (GRCm39)	D326G	probably benign	Het
Sh3tc2	A	G	18: 62,123,966 (GRCm39)	E909G	probably benign	Het
Shprh	T	A	10: 11,047,697 (GRCm39)	V1015D	probably damaging	Het
Slfn8	A	T	11: 82,894,920 (GRCm39)	Y629N	probably damaging	Het
Triml1	A	G	8: 43,594,408 (GRCm39)	S8P	probably damaging	Het

Other mutations in Enam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00769:Enam	APN	5	88,649,343 (GRCm39)	missense	possibly damaging	0.83
IGL01611:Enam	APN	5	88,651,608 (GRCm39)	missense	probably damaging	0.99
IGL01802:Enam	APN	5	88,651,533 (GRCm39)	missense	possibly damaging	0.93
IGL02220:Enam	APN	5	88,652,418 (GRCm39)	nonsense	probably null
IGL02371:Enam	APN	5	88,650,668 (GRCm39)	missense	probably benign	0.39
IGL02596:Enam	APN	5	88,650,885 (GRCm39)	missense	probably benign	0.01
IGL03026:Enam	APN	5	88,651,158 (GRCm39)	missense	probably benign	0.38
IGL03303:Enam	APN	5	88,652,450 (GRCm39)	missense	probably benign	0.12
opinionated	UTSW	5	88,650,885 (GRCm39)	missense	probably benign	0.04
recalcitrant	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R0200:Enam	UTSW	5	88,640,886 (GRCm39)	missense	possibly damaging	0.96
R0230:Enam	UTSW	5	88,637,514 (GRCm39)	splice site	probably benign
R0395:Enam	UTSW	5	88,649,367 (GRCm39)	missense	probably damaging	0.99
R0548:Enam	UTSW	5	88,650,964 (GRCm39)	missense	probably damaging	0.96
R0608:Enam	UTSW	5	88,640,886 (GRCm39)	missense	possibly damaging	0.96
R0724:Enam	UTSW	5	88,649,853 (GRCm39)	missense	probably damaging	1.00
R0927:Enam	UTSW	5	88,641,919 (GRCm39)	missense	possibly damaging	0.72
R1023:Enam	UTSW	5	88,649,826 (GRCm39)	missense	probably damaging	0.99
R1053:Enam	UTSW	5	88,651,878 (GRCm39)	missense	possibly damaging	0.64
R1169:Enam	UTSW	5	88,651,117 (GRCm39)	missense	probably damaging	1.00
R1230:Enam	UTSW	5	88,641,927 (GRCm39)	missense	probably damaging	0.99
R1324:Enam	UTSW	5	88,641,927 (GRCm39)	missense	possibly damaging	0.53
R1663:Enam	UTSW	5	88,651,853 (GRCm39)	missense	probably damaging	1.00
R1727:Enam	UTSW	5	88,651,853 (GRCm39)	missense	probably damaging	1.00
R1750:Enam	UTSW	5	88,651,086 (GRCm39)	missense	probably damaging	1.00
R1852:Enam	UTSW	5	88,652,324 (GRCm39)	missense	possibly damaging	0.92
R1907:Enam	UTSW	5	88,652,481 (GRCm39)	missense	possibly damaging	0.86
R2104:Enam	UTSW	5	88,649,646 (GRCm39)	missense	probably damaging	1.00
R2143:Enam	UTSW	5	88,640,779 (GRCm39)	missense	probably benign	0.02
R2196:Enam	UTSW	5	88,650,603 (GRCm39)	missense	probably damaging	0.99
R2497:Enam	UTSW	5	88,650,553 (GRCm39)	missense	probably benign	0.13
R3615:Enam	UTSW	5	88,652,306 (GRCm39)	missense	possibly damaging	0.81
R3616:Enam	UTSW	5	88,652,306 (GRCm39)	missense	possibly damaging	0.81
R3782:Enam	UTSW	5	88,650,674 (GRCm39)	missense	probably damaging	1.00
R4067:Enam	UTSW	5	88,651,236 (GRCm39)	missense	probably damaging	1.00
R4349:Enam	UTSW	5	88,651,407 (GRCm39)	missense	probably damaging	0.99
R4604:Enam	UTSW	5	88,652,142 (GRCm39)	missense	possibly damaging	0.93
R4649:Enam	UTSW	5	88,640,827 (GRCm39)	missense	probably benign	0.02
R4702:Enam	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R4703:Enam	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R4704:Enam	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R4705:Enam	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R4714:Enam	UTSW	5	88,651,395 (GRCm39)	missense	probably damaging	1.00
R4748:Enam	UTSW	5	88,649,402 (GRCm39)	missense	probably damaging	1.00
R4838:Enam	UTSW	5	88,640,967 (GRCm39)	nonsense	probably null
R4840:Enam	UTSW	5	88,650,885 (GRCm39)	missense	probably benign	0.04
R4856:Enam	UTSW	5	88,636,593 (GRCm39)	nonsense	probably null
R4886:Enam	UTSW	5	88,636,593 (GRCm39)	nonsense	probably null
R4910:Enam	UTSW	5	88,650,173 (GRCm39)	missense	probably benign
R4911:Enam	UTSW	5	88,650,173 (GRCm39)	missense	probably benign
R6103:Enam	UTSW	5	88,650,187 (GRCm39)	missense	probably damaging	0.96
R6651:Enam	UTSW	5	88,650,776 (GRCm39)	missense	probably damaging	0.98
R6759:Enam	UTSW	5	88,649,550 (GRCm39)	missense	probably damaging	1.00
R7282:Enam	UTSW	5	88,650,186 (GRCm39)	missense	probably damaging	0.99
R7365:Enam	UTSW	5	88,649,347 (GRCm39)	missense	possibly damaging	0.75
R7392:Enam	UTSW	5	88,649,523 (GRCm39)	missense	probably damaging	0.99
R7483:Enam	UTSW	5	88,649,679 (GRCm39)	missense	probably damaging	1.00
R7647:Enam	UTSW	5	88,650,884 (GRCm39)	missense	probably benign	0.00
R7648:Enam	UTSW	5	88,652,016 (GRCm39)	missense	possibly damaging	0.89
R7672:Enam	UTSW	5	88,651,830 (GRCm39)	missense	possibly damaging	0.80
R7943:Enam	UTSW	5	88,636,410 (GRCm39)	splice site	probably null
R7999:Enam	UTSW	5	88,651,561 (GRCm39)	missense	probably benign
R8117:Enam	UTSW	5	88,651,385 (GRCm39)	missense	probably benign	0.00
R8419:Enam	UTSW	5	88,651,209 (GRCm39)	missense	possibly damaging	0.80
R8528:Enam	UTSW	5	88,650,078 (GRCm39)	missense	probably damaging	0.98
R8836:Enam	UTSW	5	88,639,124 (GRCm39)	critical splice donor site	probably null
R8973:Enam	UTSW	5	88,641,947 (GRCm39)	missense	possibly damaging	0.96
R9001:Enam	UTSW	5	88,637,388 (GRCm39)	missense	probably benign	0.11
R9033:Enam	UTSW	5	88,646,475 (GRCm39)	missense	probably benign	0.01
R9268:Enam	UTSW	5	88,640,778 (GRCm39)	missense	probably benign	0.01
R9723:Enam	UTSW	5	88,652,241 (GRCm39)	missense	probably damaging	1.00
X0018:Enam	UTSW	5	88,650,550 (GRCm39)	nonsense	probably null
Z1176:Enam	UTSW	5	88,640,830 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACAAGAAAACATTTCCCTGCTG -3'
(R):5'- CGTAGTGCTCACCTTCATACTG -3'

Sequencing Primer
(F):5'- TTCCCTGCTGAAAGAAATACCTGG -3'
(R):5'- TCATACTGCCTAACTGTTGGG -3'

Posted On

2014-10-30