Incidental Mutation 'R2363:C1rl'
ID247218
Institutional Source Beutler Lab
Gene Symbol C1rl
Ensembl Gene ENSMUSG00000038527
Gene Namecomplement component 1, r subcomponent-like
SynonymsC1rl1, C1r-LP
MMRRC Submission 040344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2363 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124493113-124510643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 124509110 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 480 (G480D)
Ref Sequence ENSEMBL: ENSMUSP00000042883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049124] [ENSMUST00000068593]
Predicted Effect probably benign
Transcript: ENSMUST00000049124
AA Change: G480D

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042883
Gene: ENSMUSG00000038527
AA Change: G480D

DomainStartEndE-ValueType
CUB 42 166 3.19e-18 SMART
Tryp_SPc 239 474 1.25e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068593
SMART Domains Protein: ENSMUSP00000063707
Gene: ENSMUSG00000055172

DomainStartEndE-ValueType
CUB 14 140 1.56e-35 SMART
EGF_CA 141 189 1.88e-10 SMART
CUB 192 304 4.74e-35 SMART
CCP 308 370 5.56e-9 SMART
CCP 375 446 1.53e-6 SMART
Tryp_SPc 462 699 2.7e-71 SMART
Meta Mutation Damage Score 0.1499 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T C 2: 103,567,183 C153R probably damaging Het
Adam23 A G 1: 63,557,491 probably null Het
Adpgk G T 9: 59,314,853 M354I probably benign Het
Atmin G T 8: 116,954,914 probably null Het
C4b G A 17: 34,736,058 probably benign Het
Cacnb1 G A 11: 98,012,846 T127I possibly damaging Het
Cmya5 A T 13: 93,093,702 V1626E probably benign Het
Cndp2 C T 18: 84,668,569 G443S probably damaging Het
Crb1 A G 1: 139,337,278 I134T possibly damaging Het
Dnaaf3 T C 7: 4,532,277 probably null Het
Enam C T 5: 88,503,149 P764L probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbln1 G A 15: 85,227,140 probably null Het
Flnb A G 14: 7,945,950 I2452V possibly damaging Het
Fmo3 A T 1: 162,954,315 W490R probably damaging Het
Gabrb1 C T 5: 71,869,573 R106* probably null Het
Galnt4 C T 10: 99,109,061 T216I probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Golph3 A G 15: 12,349,563 D223G probably benign Het
Herc4 T A 10: 63,315,694 F905I possibly damaging Het
Il23r T C 6: 67,452,417 T314A probably benign Het
Lrrtm4 T C 6: 80,021,874 W90R probably damaging Het
Maml2 C T 9: 13,621,245 T585I probably damaging Het
Mpp3 G A 11: 102,020,486 A170V probably damaging Het
Naip6 T A 13: 100,316,420 K44N possibly damaging Het
Olfr1301 C T 2: 111,754,794 P182S probably damaging Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr250 T C 9: 38,368,098 I174T probably damaging Het
Olfr432 C T 1: 174,051,248 R292C probably damaging Het
Olfr523 A G 7: 140,176,965 T282A probably damaging Het
Olfr58 T G 9: 19,783,596 I154M probably benign Het
Olfr65 T A 7: 103,907,060 M207K probably benign Het
Pak1 T A 7: 97,886,314 V204E probably benign Het
Pcdhb10 T A 18: 37,414,137 C755* probably null Het
Pcdhb20 A G 18: 37,505,672 Y417C probably damaging Het
Pkd1l3 G T 8: 109,628,709 W723L probably benign Het
Plin1 C T 7: 79,726,391 probably null Het
Polr3a A T 14: 24,475,892 probably null Het
Ranbp2 A T 10: 58,478,936 K1826I possibly damaging Het
Rapgef1 A G 2: 29,736,596 I970V possibly damaging Het
Rdx C A 9: 52,068,873 F255L probably damaging Het
Rp1l1 A T 14: 64,029,998 H1011L possibly damaging Het
Serpina6 T C 12: 103,648,609 D326G probably benign Het
Sh3tc2 A G 18: 61,990,895 E909G probably benign Het
Shprh T A 10: 11,171,953 V1015D probably damaging Het
Slfn8 A T 11: 83,004,094 Y629N probably damaging Het
Triml1 A G 8: 43,141,371 S8P probably damaging Het
Other mutations in C1rl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02435:C1rl APN 6 124508873 missense probably damaging 1.00
IGL02549:C1rl APN 6 124493837 missense possibly damaging 0.76
IGL02581:C1rl APN 6 124493154 missense possibly damaging 0.83
IGL02642:C1rl APN 6 124493847 missense possibly damaging 0.60
IGL02950:C1rl APN 6 124508861 missense probably damaging 1.00
IGL02980:C1rl UTSW 6 124508528 missense probably benign 0.00
R0699:C1rl UTSW 6 124508636 missense probably benign 0.14
R0848:C1rl UTSW 6 124508506 missense probably benign 0.29
R1221:C1rl UTSW 6 124493981 missense probably benign 0.43
R1654:C1rl UTSW 6 124493910 missense probably damaging 0.97
R1957:C1rl UTSW 6 124509062 missense probably damaging 1.00
R2055:C1rl UTSW 6 124493822 missense probably benign 0.01
R2120:C1rl UTSW 6 124508713 missense probably damaging 0.99
R2262:C1rl UTSW 6 124506948 missense probably damaging 0.99
R3933:C1rl UTSW 6 124508822 nonsense probably null
R4824:C1rl UTSW 6 124509081 nonsense probably null
R5228:C1rl UTSW 6 124508468 missense probably damaging 1.00
R5414:C1rl UTSW 6 124508468 missense probably damaging 1.00
R6008:C1rl UTSW 6 124493188 missense probably benign 0.00
R6467:C1rl UTSW 6 124508576 missense probably benign 0.03
R6549:C1rl UTSW 6 124508528 missense probably benign 0.00
R6609:C1rl UTSW 6 124508624 missense probably benign 0.44
R6998:C1rl UTSW 6 124508902 missense probably damaging 1.00
R7037:C1rl UTSW 6 124508639 missense probably damaging 1.00
Z1088:C1rl UTSW 6 124508742 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCAGGTGAACAGTGTCTG -3'
(R):5'- TGGGTTGCTGAATCAGTGAC -3'

Sequencing Primer
(F):5'- TGAACAGTGTCTGCCAGGG -3'
(R):5'- GTCCTGGAACTCAATCTGTAGAC -3'
Posted On2014-10-30