Incidental Mutation 'R2363:Triml1'
ID247224
Institutional Source Beutler Lab
Gene Symbol Triml1
Ensembl Gene ENSMUSG00000031651
Gene Nametripartite motif family-like 1
Synonyms
MMRRC Submission 040344-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R2363 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location43129807-43141486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43141371 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 8 (S8P)
Ref Sequence ENSEMBL: ENSMUSP00000050267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059692]
Predicted Effect probably damaging
Transcript: ENSMUST00000059692
AA Change: S8P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050267
Gene: ENSMUSG00000031651
AA Change: S8P

DomainStartEndE-ValueType
RING 22 62 1.14e-8 SMART
coiled coil region 196 235 N/A INTRINSIC
PRY 291 343 4.64e-23 SMART
Pfam:SPRY 346 462 6.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211541
Meta Mutation Damage Score 0.0923 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tripartite motif family protein with similarities to E3 ubiquitin-protein ligases. While the function of the encoded protein has not been determined, the orthologous protein in mouse has been shown to bind ubiquitin-specific protease 5 and is involved in the blastocyst development stage. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T C 2: 103,567,183 C153R probably damaging Het
Adam23 A G 1: 63,557,491 probably null Het
Adpgk G T 9: 59,314,853 M354I probably benign Het
Atmin G T 8: 116,954,914 probably null Het
C1rl G A 6: 124,509,110 G480D probably benign Het
C4b G A 17: 34,736,058 probably benign Het
Cacnb1 G A 11: 98,012,846 T127I possibly damaging Het
Cmya5 A T 13: 93,093,702 V1626E probably benign Het
Cndp2 C T 18: 84,668,569 G443S probably damaging Het
Crb1 A G 1: 139,337,278 I134T possibly damaging Het
Dnaaf3 T C 7: 4,532,277 probably null Het
Enam C T 5: 88,503,149 P764L probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbln1 G A 15: 85,227,140 probably null Het
Flnb A G 14: 7,945,950 I2452V possibly damaging Het
Fmo3 A T 1: 162,954,315 W490R probably damaging Het
Gabrb1 C T 5: 71,869,573 R106* probably null Het
Galnt4 C T 10: 99,109,061 T216I probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Golph3 A G 15: 12,349,563 D223G probably benign Het
Herc4 T A 10: 63,315,694 F905I possibly damaging Het
Il23r T C 6: 67,452,417 T314A probably benign Het
Lrrtm4 T C 6: 80,021,874 W90R probably damaging Het
Maml2 C T 9: 13,621,245 T585I probably damaging Het
Mpp3 G A 11: 102,020,486 A170V probably damaging Het
Naip6 T A 13: 100,316,420 K44N possibly damaging Het
Olfr1301 C T 2: 111,754,794 P182S probably damaging Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr250 T C 9: 38,368,098 I174T probably damaging Het
Olfr432 C T 1: 174,051,248 R292C probably damaging Het
Olfr523 A G 7: 140,176,965 T282A probably damaging Het
Olfr58 T G 9: 19,783,596 I154M probably benign Het
Olfr65 T A 7: 103,907,060 M207K probably benign Het
Pak1 T A 7: 97,886,314 V204E probably benign Het
Pcdhb10 T A 18: 37,414,137 C755* probably null Het
Pcdhb20 A G 18: 37,505,672 Y417C probably damaging Het
Pkd1l3 G T 8: 109,628,709 W723L probably benign Het
Plin1 C T 7: 79,726,391 probably null Het
Polr3a A T 14: 24,475,892 probably null Het
Ranbp2 A T 10: 58,478,936 K1826I possibly damaging Het
Rapgef1 A G 2: 29,736,596 I970V possibly damaging Het
Rdx C A 9: 52,068,873 F255L probably damaging Het
Rp1l1 A T 14: 64,029,998 H1011L possibly damaging Het
Serpina6 T C 12: 103,648,609 D326G probably benign Het
Sh3tc2 A G 18: 61,990,895 E909G probably benign Het
Shprh T A 10: 11,171,953 V1015D probably damaging Het
Slfn8 A T 11: 83,004,094 Y629N probably damaging Het
Other mutations in Triml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Triml1 APN 8 43140961 splice site probably benign
IGL00920:Triml1 APN 8 43138682 missense probably damaging 1.00
IGL01319:Triml1 APN 8 43141397 utr 5 prime probably benign
IGL01323:Triml1 APN 8 43138563 splice site probably null
IGL01998:Triml1 APN 8 43141313 missense probably damaging 1.00
IGL02394:Triml1 APN 8 43138592 missense possibly damaging 0.57
R0359:Triml1 UTSW 8 43130505 missense probably damaging 1.00
R0400:Triml1 UTSW 8 43141040 missense probably benign 0.03
R1799:Triml1 UTSW 8 43130475 missense probably damaging 1.00
R2008:Triml1 UTSW 8 43130605 missense probably damaging 0.97
R2405:Triml1 UTSW 8 43130283 missense probably damaging 1.00
R5333:Triml1 UTSW 8 43130290 missense possibly damaging 0.82
R6093:Triml1 UTSW 8 43140718 missense probably benign 0.04
R6244:Triml1 UTSW 8 43138756 nonsense probably null
R6808:Triml1 UTSW 8 43141221 missense probably damaging 0.99
R6860:Triml1 UTSW 8 43130566 missense probably damaging 1.00
R7231:Triml1 UTSW 8 43136371 missense probably benign
R7826:Triml1 UTSW 8 43138766 missense possibly damaging 0.95
R8054:Triml1 UTSW 8 43130383 missense probably damaging 0.99
R8100:Triml1 UTSW 8 43138680 missense probably benign
R8234:Triml1 UTSW 8 43141248 missense probably benign 0.25
Z1088:Triml1 UTSW 8 43130398 missense probably damaging 1.00
Z1177:Triml1 UTSW 8 43140705 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GGCTTGAAAATGTGGGGCTC -3'
(R):5'- CCCAGGAGTTCCACATTAAGTC -3'

Sequencing Primer
(F):5'- GGCTCCCAAAGTCCTCCAG -3'
(R):5'- AAGTCACAATTGGCTTTGTGC -3'
Posted On2014-10-30