Mutagenetix > Incidental Mutation

Incidental Mutation 'R2363:Rdx'

247231

Institutional Source

Beutler Lab

Gene Symbol

Rdx

Ensembl Gene

ENSMUSG00000032050

Gene Name

radixin

Synonyms

MMRRC Submission

040344-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2363 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52047173-52088735 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 52068873 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 255 (F255L)

Ref Sequence

ENSEMBL: ENSMUSP00000128249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000590] [ENSMUST00000061352] [ENSMUST00000163153]

AlphaFold

P26043

PDB Structure

CRYSTAL STRUCTURE OF THE RADIXIN FERM DOMAIN COMPLEXED WITH INOSITOL-(1,4,5)-TRIPHOSPHATE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RADIXIN FERM DOMAIN [X-RAY DIFFRACTION]
Crystal structure of the radxin FERM domain complexed with the ICAM-2 cytoplasmic peptide [X-RAY DIFFRACTION]
Crystal structure of the Radixin FERM domain complexed with the NHERF-1 C-terminal tail peptide [X-RAY DIFFRACTION]
Crystal structure of the Radixin FERM domain complexed with the NHERF-2 C-terminal tail peptide [X-RAY DIFFRACTION]
Crystal structure of the dimerized radixin FERM domain [X-RAY DIFFRACTION]
Crystal Structure Analysis of the radixin FERM domain complexed with adhesion molecule CD43 [X-RAY DIFFRACTION]
Crystal Structure Analysis of the radixin FERM domain complexed with adhesion molecule PSGL-1 [X-RAY DIFFRACTION]
Crystal structure of the Radixin FERM domain complexed with the NEP cytoplasmic tail [X-RAY DIFFRACTION]
Crystal structure of the mouse radxin FERM domain complexed with the mouse CD44 cytoplasmic peptide [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000000590
AA Change: F255L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000000590
Gene: ENSMUSG00000032050
AA Change: F255L

Domain	Start	End	E-Value	Type
B41	1	206	4.99e-82	SMART
FERM_C	210	299	1.43e-35	SMART
Pfam:ERM	338	583	6e-85	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061352
AA Change: F255L

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000055303
Gene: ENSMUSG00000032050
AA Change: F255L

Domain	Start	End	E-Value	Type
B41	1	206	4.99e-82	SMART
FERM_C	210	299	1.43e-35	SMART
coiled coil region	300	365	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000163153
AA Change: F255L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128249
Gene: ENSMUSG00000032050
AA Change: F255L

Domain	Start	End	E-Value	Type
B41	1	206	4.99e-82	SMART
FERM_C	210	299	1.43e-35	SMART
Pfam:ERM	338	583	3.4e-78	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted mutation display mild degenerative changes in the liver and hyperbilirubinemia. Adult homozygotes exhibit profound deafness, but not imbalance, associated with progressive degeneration of stereocilia of cochlear hair cells after the onset of hearing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	T	C	2: 103,567,183	C153R	probably damaging	Het
Adam23	A	G	1: 63,557,491		probably null	Het
Adpgk	G	T	9: 59,314,853	M354I	probably benign	Het
Atmin	G	T	8: 116,954,914		probably null	Het
C1rl	G	A	6: 124,509,110	G480D	probably benign	Het
C4b	G	A	17: 34,736,058		probably benign	Het
Cacnb1	G	A	11: 98,012,846	T127I	possibly damaging	Het
Cmya5	A	T	13: 93,093,702	V1626E	probably benign	Het
Cndp2	C	T	18: 84,668,569	G443S	probably damaging	Het
Crb1	A	G	1: 139,337,278	I134T	possibly damaging	Het
Dnaaf3	T	C	7: 4,532,277		probably null	Het
Enam	C	T	5: 88,503,149	P764L	probably benign	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fbln1	G	A	15: 85,227,140		probably null	Het
Flnb	A	G	14: 7,945,950	I2452V	possibly damaging	Het
Fmo3	A	T	1: 162,954,315	W490R	probably damaging	Het
Gabrb1	C	T	5: 71,869,573	R106*	probably null	Het
Galnt4	C	T	10: 99,109,061	T216I	probably damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Golph3	A	G	15: 12,349,563	D223G	probably benign	Het
Herc4	T	A	10: 63,315,694	F905I	possibly damaging	Het
Il23r	T	C	6: 67,452,417	T314A	probably benign	Het
Lrrtm4	T	C	6: 80,021,874	W90R	probably damaging	Het
Maml2	C	T	9: 13,621,245	T585I	probably damaging	Het
Mpp3	G	A	11: 102,020,486	A170V	probably damaging	Het
Naip6	T	A	13: 100,316,420	K44N	possibly damaging	Het
Olfr1301	C	T	2: 111,754,794	P182S	probably damaging	Het
Olfr1328	C	T	4: 118,934,033	E272K	probably benign	Het
Olfr23	A	G	11: 73,940,356	T37A	possibly damaging	Het
Olfr250	T	C	9: 38,368,098	I174T	probably damaging	Het
Olfr432	C	T	1: 174,051,248	R292C	probably damaging	Het
Olfr523	A	G	7: 140,176,965	T282A	probably damaging	Het
Olfr58	T	G	9: 19,783,596	I154M	probably benign	Het
Olfr65	T	A	7: 103,907,060	M207K	probably benign	Het
Pak1	T	A	7: 97,886,314	V204E	probably benign	Het
Pcdhb10	T	A	18: 37,414,137	C755*	probably null	Het
Pcdhb20	A	G	18: 37,505,672	Y417C	probably damaging	Het
Pkd1l3	G	T	8: 109,628,709	W723L	probably benign	Het
Plin1	C	T	7: 79,726,391		probably null	Het
Polr3a	A	T	14: 24,475,892		probably null	Het
Ranbp2	A	T	10: 58,478,936	K1826I	possibly damaging	Het
Rapgef1	A	G	2: 29,736,596	I970V	possibly damaging	Het
Rp1l1	A	T	14: 64,029,998	H1011L	possibly damaging	Het
Serpina6	T	C	12: 103,648,609	D326G	probably benign	Het
Sh3tc2	A	G	18: 61,990,895	E909G	probably benign	Het
Shprh	T	A	10: 11,171,953	V1015D	probably damaging	Het
Slfn8	A	T	11: 83,004,094	Y629N	probably damaging	Het
Triml1	A	G	8: 43,141,371	S8P	probably damaging	Het

Other mutations in Rdx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Rdx	APN	9	52086346	missense	probably damaging	1.00
IGL02088:Rdx	APN	9	52060883	utr 5 prime	probably benign
IGL02522:Rdx	APN	9	52068204	missense	possibly damaging	0.92
R0731:Rdx	UTSW	9	52068218	missense	probably benign	0.05
R0748:Rdx	UTSW	9	52064860	missense	possibly damaging	0.87
R0831:Rdx	UTSW	9	52065817	missense	probably damaging	1.00
R1605:Rdx	UTSW	9	52063591	missense	probably damaging	1.00
R1688:Rdx	UTSW	9	52060911	splice site	probably benign
R2127:Rdx	UTSW	9	52069732	missense	possibly damaging	0.49
R2899:Rdx	UTSW	9	52068911	splice site	probably benign
R4184:Rdx	UTSW	9	52067380	missense	probably damaging	1.00
R4569:Rdx	UTSW	9	52068841	missense	probably benign	0.07
R4607:Rdx	UTSW	9	52068837	missense	probably damaging	0.99
R4760:Rdx	UTSW	9	52065874	missense	probably benign	0.02
R4820:Rdx	UTSW	9	52063591	missense	probably damaging	1.00
R4966:Rdx	UTSW	9	52075009	missense	probably benign	0.00
R6707:Rdx	UTSW	9	52063654	missense	probably damaging	1.00
R7136:Rdx	UTSW	9	52086445	missense	probably damaging	1.00
R7308:Rdx	UTSW	9	52068870	missense	probably damaging	0.98
R7597:Rdx	UTSW	9	52060896	missense	possibly damaging	0.84
R7835:Rdx	UTSW	9	52065788	missense	probably damaging	0.98
R7923:Rdx	UTSW	9	52065901	missense	possibly damaging	0.93
R8055:Rdx	UTSW	9	52086424	missense	probably damaging	1.00
R8057:Rdx	UTSW	9	52065646	missense	probably damaging	1.00
R8889:Rdx	UTSW	9	52086453	missense	probably damaging	1.00
R8983:Rdx	UTSW	9	52063605	missense	probably damaging	1.00
R9128:Rdx	UTSW	9	52064879	nonsense	probably null
R9226:Rdx	UTSW	9	52081168	missense	probably benign	0.01
R9377:Rdx	UTSW	9	52068868	missense	possibly damaging	0.83
R9469:Rdx	UTSW	9	52065769	missense	probably damaging	1.00
R9534:Rdx	UTSW	9	52073182	nonsense	probably null
R9746:Rdx	UTSW	9	52063578	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGGCTCTTAAGATTGGTCATTCATG -3'
(R):5'- AGGGTTACCTCTACTACATTTTGC -3'

Sequencing Primer
(F):5'- ATGTAACCTGTCCCAGTAGGCTG -3'
(R):5'- GCAATCAATAAGTGTTGTTAATACCC -3'

Posted On

2014-10-30