Incidental Mutation 'R2363:Galnt4'
ID247236
Institutional Source Beutler Lab
Gene Symbol Galnt4
Ensembl Gene ENSMUSG00000090035
Gene Namepolypeptide N-acetylgalactosaminyltransferase 4
SynonymsppGaNTase-T4
MMRRC Submission 040344-MU
Accession Numbers

Genbank: NM_015737; MGI: 894692

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2363 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location99108159-99113247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99109061 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 216 (T216I)
Ref Sequence ENSEMBL: ENSMUSP00000125315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020113] [ENSMUST00000159228] [ENSMUST00000159990] [ENSMUST00000161240] [ENSMUST00000219884]
Predicted Effect probably benign
Transcript: ENSMUST00000020113
SMART Domains Protein: ENSMUSP00000020113
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 7 46 1.71e-7 SMART
WD40 49 88 8.68e-9 SMART
WD40 91 130 2.71e-10 SMART
WD40 133 172 2.43e-12 SMART
WD40 175 214 2.07e-6 SMART
WD40 217 256 1.71e-7 SMART
WD40 259 298 7.55e-9 SMART
coiled coil region 428 468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159228
SMART Domains Protein: ENSMUSP00000124144
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 7 46 1.71e-7 SMART
WD40 49 88 8.68e-9 SMART
WD40 91 130 2.71e-10 SMART
WD40 133 172 2.43e-12 SMART
WD40 175 214 2.07e-6 SMART
WD40 217 256 1.71e-7 SMART
WD40 259 298 7.55e-9 SMART
coiled coil region 401 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159990
SMART Domains Protein: ENSMUSP00000125423
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 7 46 8.68e-9 SMART
WD40 49 88 2.71e-10 SMART
WD40 91 130 2.43e-12 SMART
WD40 133 172 2.07e-6 SMART
WD40 175 214 1.71e-7 SMART
WD40 217 256 7.55e-9 SMART
coiled coil region 386 426 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161240
AA Change: T216I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125315
Gene: ENSMUSG00000090035
AA Change: T216I

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 135 382 4.7e-10 PFAM
Pfam:Glycos_transf_2 138 321 7.5e-38 PFAM
Pfam:Glyco_tranf_2_2 138 368 1e-7 PFAM
Pfam:Glyco_transf_7C 298 367 4.5e-10 PFAM
low complexity region 411 420 N/A INTRINSIC
RICIN 445 577 2.39e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218379
Predicted Effect probably benign
Transcript: ENSMUST00000219884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220019
Meta Mutation Damage Score 0.3348 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. In vitro, the encoded protein can complement other GalNAc-Ts in the complete O-glycosylation of the mucin-1 tandem repeat and can O-glycosylate the P-selectin glycoprotein ligand-1 molecule. The coding region of this gene is contained within a single exon. Fusion transcripts, which combine part of this gene with the 5' exons of the neighboring POC1B (POC1 centriolar protein homolog B) gene, also exist. [provided by RefSeq, Dec 2010]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T C 2: 103,567,183 C153R probably damaging Het
Adam23 A G 1: 63,557,491 probably null Het
Adpgk G T 9: 59,314,853 M354I probably benign Het
Atmin G T 8: 116,954,914 probably null Het
C1rl G A 6: 124,509,110 G480D probably benign Het
C4b G A 17: 34,736,058 probably benign Het
Cacnb1 G A 11: 98,012,846 T127I possibly damaging Het
Cmya5 A T 13: 93,093,702 V1626E probably benign Het
Cndp2 C T 18: 84,668,569 G443S probably damaging Het
Crb1 A G 1: 139,337,278 I134T possibly damaging Het
Dnaaf3 T C 7: 4,532,277 probably null Het
Enam C T 5: 88,503,149 P764L probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbln1 G A 15: 85,227,140 probably null Het
Flnb A G 14: 7,945,950 I2452V possibly damaging Het
Fmo3 A T 1: 162,954,315 W490R probably damaging Het
Gabrb1 C T 5: 71,869,573 R106* probably null Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Golph3 A G 15: 12,349,563 D223G probably benign Het
Herc4 T A 10: 63,315,694 F905I possibly damaging Het
Il23r T C 6: 67,452,417 T314A probably benign Het
Lrrtm4 T C 6: 80,021,874 W90R probably damaging Het
Maml2 C T 9: 13,621,245 T585I probably damaging Het
Mpp3 G A 11: 102,020,486 A170V probably damaging Het
Naip6 T A 13: 100,316,420 K44N possibly damaging Het
Olfr1301 C T 2: 111,754,794 P182S probably damaging Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr250 T C 9: 38,368,098 I174T probably damaging Het
Olfr432 C T 1: 174,051,248 R292C probably damaging Het
Olfr523 A G 7: 140,176,965 T282A probably damaging Het
Olfr58 T G 9: 19,783,596 I154M probably benign Het
Olfr65 T A 7: 103,907,060 M207K probably benign Het
Pak1 T A 7: 97,886,314 V204E probably benign Het
Pcdhb10 T A 18: 37,414,137 C755* probably null Het
Pcdhb20 A G 18: 37,505,672 Y417C probably damaging Het
Pkd1l3 G T 8: 109,628,709 W723L probably benign Het
Plin1 C T 7: 79,726,391 probably null Het
Polr3a A T 14: 24,475,892 probably null Het
Ranbp2 A T 10: 58,478,936 K1826I possibly damaging Het
Rapgef1 A G 2: 29,736,596 I970V possibly damaging Het
Rdx C A 9: 52,068,873 F255L probably damaging Het
Rp1l1 A T 14: 64,029,998 H1011L possibly damaging Het
Serpina6 T C 12: 103,648,609 D326G probably benign Het
Sh3tc2 A G 18: 61,990,895 E909G probably benign Het
Shprh T A 10: 11,171,953 V1015D probably damaging Het
Slfn8 A T 11: 83,004,094 Y629N probably damaging Het
Triml1 A G 8: 43,141,371 S8P probably damaging Het
Other mutations in Galnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Galnt4 APN 10 99109597 missense probably damaging 1.00
IGL01725:Galnt4 APN 10 99109957 missense probably damaging 1.00
IGL01871:Galnt4 APN 10 99109241 missense probably damaging 1.00
IGL02146:Galnt4 APN 10 99109701 missense possibly damaging 0.87
3-1:Galnt4 UTSW 10 99109265 missense probably damaging 1.00
R0041:Galnt4 UTSW 10 99108512 missense probably benign 0.08
R1318:Galnt4 UTSW 10 99109910 missense probably damaging 0.99
R1466:Galnt4 UTSW 10 99108709 missense probably benign 0.43
R1466:Galnt4 UTSW 10 99108709 missense probably benign 0.43
R1471:Galnt4 UTSW 10 99108674 missense probably benign
R1633:Galnt4 UTSW 10 99109952 missense possibly damaging 0.88
R2088:Galnt4 UTSW 10 99109184 missense probably damaging 1.00
R2197:Galnt4 UTSW 10 99108647 missense probably damaging 1.00
R2507:Galnt4 UTSW 10 99109286 missense possibly damaging 0.78
R3104:Galnt4 UTSW 10 99109381 missense probably benign 0.10
R3106:Galnt4 UTSW 10 99109381 missense probably benign 0.10
R4599:Galnt4 UTSW 10 99109493 missense probably damaging 1.00
R4670:Galnt4 UTSW 10 99109298 missense possibly damaging 0.60
R4756:Galnt4 UTSW 10 99108500 missense probably benign
R5660:Galnt4 UTSW 10 99109535 missense probably benign 0.16
R5819:Galnt4 UTSW 10 99110030 missense probably damaging 1.00
R6441:Galnt4 UTSW 10 99110098 missense possibly damaging 0.95
R7184:Galnt4 UTSW 10 99108604 missense probably damaging 1.00
R7429:Galnt4 UTSW 10 99109748 missense probably damaging 1.00
R7685:Galnt4 UTSW 10 99109964 missense probably benign 0.00
R7788:Galnt4 UTSW 10 99109113 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTAGAAACTTCTCCAGCTGTGC -3'
(R):5'- CATGTTTGGGGACAGAATGCC -3'

Sequencing Primer
(F):5'- CTCCAGCTGTGCTTTTAAAGGAGATC -3'
(R):5'- CTGGAAGGTCAAACGCCAGTC -3'
Posted On2014-10-30