Incidental Mutation 'R2363:Cacnb1'
ID247239
Institutional Source Beutler Lab
Gene Symbol Cacnb1
Ensembl Gene ENSMUSG00000020882
Gene Namecalcium channel, voltage-dependent, beta 1 subunit
SynonymsCchb1, Cchlb1
MMRRC Submission 040344-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2363 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98001508-98023034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98012846 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 127 (T127I)
Ref Sequence ENSEMBL: ENSMUSP00000099433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017552] [ENSMUST00000092736] [ENSMUST00000103144] [ENSMUST00000107561] [ENSMUST00000107562]
Predicted Effect probably benign
Transcript: ENSMUST00000017552
AA Change: T127I

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000017552
Gene: ENSMUSG00000020882
AA Change: T127I

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 58 99 1.1e-26 PFAM
SH3 103 167 2.98e-2 SMART
low complexity region 182 193 N/A INTRINSIC
GuKc 228 409 5.57e-41 SMART
low complexity region 412 443 N/A INTRINSIC
low complexity region 523 543 N/A INTRINSIC
low complexity region 549 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092736
AA Change: T127I

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090412
Gene: ENSMUSG00000020882
AA Change: T127I

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 58 99 4.7e-26 PFAM
SH3 103 167 2.98e-2 SMART
low complexity region 182 193 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
GuKc 273 454 5.57e-41 SMART
low complexity region 457 488 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103144
AA Change: T127I

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099433
Gene: ENSMUSG00000020882
AA Change: T127I

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 58 99 1.4e-25 PFAM
SH3 103 167 2.98e-2 SMART
low complexity region 182 193 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
GuKc 273 454 5.57e-41 SMART
low complexity region 457 488 N/A INTRINSIC
low complexity region 603 623 N/A INTRINSIC
low complexity region 629 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107561
AA Change: T80I

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103186
Gene: ENSMUSG00000020882
AA Change: T80I

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 11 52 8e-27 PFAM
SH3 56 120 2.98e-2 SMART
low complexity region 135 146 N/A INTRINSIC
low complexity region 172 187 N/A INTRINSIC
GuKc 226 407 5.57e-41 SMART
low complexity region 410 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107562
AA Change: T127I

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103187
Gene: ENSMUSG00000020882
AA Change: T127I

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 58 99 4.2e-26 PFAM
SH3 103 167 2.98e-2 SMART
low complexity region 182 193 N/A INTRINSIC
GuKc 228 409 5.57e-41 SMART
low complexity region 412 443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135462
Meta Mutation Damage Score 0.1298 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the calcium channel beta subunit family. It plays an important role in the calcium channel by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant animals have reduced muscle mass, thin limbs, a curved spine, and flexed necks and extremeties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T C 2: 103,567,183 C153R probably damaging Het
Adam23 A G 1: 63,557,491 probably null Het
Adpgk G T 9: 59,314,853 M354I probably benign Het
Atmin G T 8: 116,954,914 probably null Het
C1rl G A 6: 124,509,110 G480D probably benign Het
C4b G A 17: 34,736,058 probably benign Het
Cmya5 A T 13: 93,093,702 V1626E probably benign Het
Cndp2 C T 18: 84,668,569 G443S probably damaging Het
Crb1 A G 1: 139,337,278 I134T possibly damaging Het
Dnaaf3 T C 7: 4,532,277 probably null Het
Enam C T 5: 88,503,149 P764L probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbln1 G A 15: 85,227,140 probably null Het
Flnb A G 14: 7,945,950 I2452V possibly damaging Het
Fmo3 A T 1: 162,954,315 W490R probably damaging Het
Gabrb1 C T 5: 71,869,573 R106* probably null Het
Galnt4 C T 10: 99,109,061 T216I probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Golph3 A G 15: 12,349,563 D223G probably benign Het
Herc4 T A 10: 63,315,694 F905I possibly damaging Het
Il23r T C 6: 67,452,417 T314A probably benign Het
Lrrtm4 T C 6: 80,021,874 W90R probably damaging Het
Maml2 C T 9: 13,621,245 T585I probably damaging Het
Mpp3 G A 11: 102,020,486 A170V probably damaging Het
Naip6 T A 13: 100,316,420 K44N possibly damaging Het
Olfr1301 C T 2: 111,754,794 P182S probably damaging Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr250 T C 9: 38,368,098 I174T probably damaging Het
Olfr432 C T 1: 174,051,248 R292C probably damaging Het
Olfr523 A G 7: 140,176,965 T282A probably damaging Het
Olfr58 T G 9: 19,783,596 I154M probably benign Het
Olfr65 T A 7: 103,907,060 M207K probably benign Het
Pak1 T A 7: 97,886,314 V204E probably benign Het
Pcdhb10 T A 18: 37,414,137 C755* probably null Het
Pcdhb20 A G 18: 37,505,672 Y417C probably damaging Het
Pkd1l3 G T 8: 109,628,709 W723L probably benign Het
Plin1 C T 7: 79,726,391 probably null Het
Polr3a A T 14: 24,475,892 probably null Het
Ranbp2 A T 10: 58,478,936 K1826I possibly damaging Het
Rapgef1 A G 2: 29,736,596 I970V possibly damaging Het
Rdx C A 9: 52,068,873 F255L probably damaging Het
Rp1l1 A T 14: 64,029,998 H1011L possibly damaging Het
Serpina6 T C 12: 103,648,609 D326G probably benign Het
Sh3tc2 A G 18: 61,990,895 E909G probably benign Het
Shprh T A 10: 11,171,953 V1015D probably damaging Het
Slfn8 A T 11: 83,004,094 Y629N probably damaging Het
Triml1 A G 8: 43,141,371 S8P probably damaging Het
Other mutations in Cacnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Cacnb1 APN 11 98022364 missense possibly damaging 0.50
IGL02633:Cacnb1 APN 11 98022373 missense probably damaging 0.98
awkward UTSW 11 98005782 missense probably damaging 1.00
R1037:Cacnb1 UTSW 11 98005017 utr 3 prime probably benign
R2101:Cacnb1 UTSW 11 98005728 missense probably damaging 1.00
R4159:Cacnb1 UTSW 11 98012274 missense probably damaging 1.00
R4942:Cacnb1 UTSW 11 98002983 missense probably damaging 1.00
R5360:Cacnb1 UTSW 11 98018271 critical splice donor site probably null
R5653:Cacnb1 UTSW 11 98009279 critical splice donor site probably null
R6137:Cacnb1 UTSW 11 98005782 missense probably damaging 1.00
R7154:Cacnb1 UTSW 11 98005133 missense probably damaging 0.99
R7163:Cacnb1 UTSW 11 98012900 missense probably benign 0.20
R7800:Cacnb1 UTSW 11 98009295 missense possibly damaging 0.56
R7816:Cacnb1 UTSW 11 98005289 missense probably damaging 1.00
R8143:Cacnb1 UTSW 11 98003320 missense probably benign 0.00
Z1176:Cacnb1 UTSW 11 98022555 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GAAAGCAGACACATGCACCG -3'
(R):5'- ACCCGTCGCTTTTGTATTGT -3'

Sequencing Primer
(F):5'- GTCACTGCGACTTAGGCATTAC -3'
(R):5'- CCCGTCGCTTTTGTATTGTAAAAG -3'
Posted On2014-10-30