Incidental Mutation 'R2363:Serpina6'
ID247241
Institutional Source Beutler Lab
Gene Symbol Serpina6
Ensembl Gene ENSMUSG00000060807
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 6
SynonymsCbg
MMRRC Submission 040344-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2363 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location103646630-103657212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103648609 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 326 (D326G)
Ref Sequence ENSEMBL: ENSMUSP00000044033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044159]
Predicted Effect probably benign
Transcript: ENSMUST00000044159
AA Change: D326G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044033
Gene: ENSMUSG00000060807
AA Change: D326G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SERPIN 43 396 3.45e-160 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to the serpin (serine protease inhibitor) family. The encoded protein is an alpha-globulin with corticosteroid-binding properties. This is the major transport protein for glucorticoids and progestins in the blood of most vertebrates. The gene localizes to a chromosomal region containing several closely related serine protease inhibitors. [provided by RefSeq, Sep 2015]
PHENOTYPE: Null homozygotes exhibit reduced total plasma corticosterone, increased susceptibility to bacterial infection, attenuation of the stress-induced surge in free corticosterone, and enhanced behavioral response to intense or uncontrollable stress. They exhibit no locomotor sensitization to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T C 2: 103,567,183 C153R probably damaging Het
Adam23 A G 1: 63,557,491 probably null Het
Adpgk G T 9: 59,314,853 M354I probably benign Het
Atmin G T 8: 116,954,914 probably null Het
C1rl G A 6: 124,509,110 G480D probably benign Het
C4b G A 17: 34,736,058 probably benign Het
Cacnb1 G A 11: 98,012,846 T127I possibly damaging Het
Cmya5 A T 13: 93,093,702 V1626E probably benign Het
Cndp2 C T 18: 84,668,569 G443S probably damaging Het
Crb1 A G 1: 139,337,278 I134T possibly damaging Het
Dnaaf3 T C 7: 4,532,277 probably null Het
Enam C T 5: 88,503,149 P764L probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbln1 G A 15: 85,227,140 probably null Het
Flnb A G 14: 7,945,950 I2452V possibly damaging Het
Fmo3 A T 1: 162,954,315 W490R probably damaging Het
Gabrb1 C T 5: 71,869,573 R106* probably null Het
Galnt4 C T 10: 99,109,061 T216I probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Golph3 A G 15: 12,349,563 D223G probably benign Het
Herc4 T A 10: 63,315,694 F905I possibly damaging Het
Il23r T C 6: 67,452,417 T314A probably benign Het
Lrrtm4 T C 6: 80,021,874 W90R probably damaging Het
Maml2 C T 9: 13,621,245 T585I probably damaging Het
Mpp3 G A 11: 102,020,486 A170V probably damaging Het
Naip6 T A 13: 100,316,420 K44N possibly damaging Het
Olfr1301 C T 2: 111,754,794 P182S probably damaging Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr250 T C 9: 38,368,098 I174T probably damaging Het
Olfr432 C T 1: 174,051,248 R292C probably damaging Het
Olfr523 A G 7: 140,176,965 T282A probably damaging Het
Olfr58 T G 9: 19,783,596 I154M probably benign Het
Olfr65 T A 7: 103,907,060 M207K probably benign Het
Pak1 T A 7: 97,886,314 V204E probably benign Het
Pcdhb10 T A 18: 37,414,137 C755* probably null Het
Pcdhb20 A G 18: 37,505,672 Y417C probably damaging Het
Pkd1l3 G T 8: 109,628,709 W723L probably benign Het
Plin1 C T 7: 79,726,391 probably null Het
Polr3a A T 14: 24,475,892 probably null Het
Ranbp2 A T 10: 58,478,936 K1826I possibly damaging Het
Rapgef1 A G 2: 29,736,596 I970V possibly damaging Het
Rdx C A 9: 52,068,873 F255L probably damaging Het
Rp1l1 A T 14: 64,029,998 H1011L possibly damaging Het
Sh3tc2 A G 18: 61,990,895 E909G probably benign Het
Shprh T A 10: 11,171,953 V1015D probably damaging Het
Slfn8 A T 11: 83,004,094 Y629N probably damaging Het
Triml1 A G 8: 43,141,371 S8P probably damaging Het
Other mutations in Serpina6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Serpina6 APN 12 103651903 missense probably damaging 1.00
IGL00910:Serpina6 APN 12 103651965 unclassified probably benign
IGL01512:Serpina6 APN 12 103654059 missense probably damaging 0.96
IGL02994:Serpina6 APN 12 103653951 missense probably benign 0.03
IGL03092:Serpina6 APN 12 103653895 critical splice donor site probably null
IGL03351:Serpina6 APN 12 103646913 missense probably damaging 1.00
R0178:Serpina6 UTSW 12 103646913 missense probably damaging 0.98
R0362:Serpina6 UTSW 12 103651949 missense probably damaging 0.98
R0530:Serpina6 UTSW 12 103651794 missense probably damaging 1.00
R1542:Serpina6 UTSW 12 103654473 missense probably benign 0.09
R1573:Serpina6 UTSW 12 103651753 missense probably damaging 1.00
R1764:Serpina6 UTSW 12 103653923 missense probably damaging 1.00
R2243:Serpina6 UTSW 12 103646928 missense probably benign 0.00
R2309:Serpina6 UTSW 12 103654179 missense probably benign 0.00
R3691:Serpina6 UTSW 12 103654409 missense probably benign 0.00
R4492:Serpina6 UTSW 12 103646887 missense probably damaging 1.00
R4498:Serpina6 UTSW 12 103654067 missense probably benign 0.02
R4953:Serpina6 UTSW 12 103651962 critical splice acceptor site probably null
R4985:Serpina6 UTSW 12 103653936 missense probably benign 0.00
R5022:Serpina6 UTSW 12 103651712 missense probably damaging 1.00
R5230:Serpina6 UTSW 12 103651898 missense probably benign 0.18
R5318:Serpina6 UTSW 12 103653962 missense possibly damaging 0.68
R5350:Serpina6 UTSW 12 103648579 missense possibly damaging 0.68
R5569:Serpina6 UTSW 12 103654460 missense possibly damaging 0.90
R5664:Serpina6 UTSW 12 103654467 missense probably damaging 0.97
R5882:Serpina6 UTSW 12 103654235 missense probably benign 0.00
R6275:Serpina6 UTSW 12 103648720 missense probably benign 0.01
R6364:Serpina6 UTSW 12 103654236 missense probably benign
R7173:Serpina6 UTSW 12 103646994 missense possibly damaging 0.78
R7181:Serpina6 UTSW 12 103646944 missense probably benign 0.00
R7725:Serpina6 UTSW 12 103648677 nonsense probably null
R7811:Serpina6 UTSW 12 103654136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTCATCCCATGGTAGCC -3'
(R):5'- GATATGCTGCTGTCTACTGCC -3'

Sequencing Primer
(F):5'- GTTCATCCCATGGTAGCCAAGATG -3'
(R):5'- TGTCTACTGCCAGGCCTAG -3'
Posted On2014-10-30