Incidental Mutation 'R2363:Polr3a'
ID 247245
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Name polymerase (RNA) III (DNA directed) polypeptide A
Synonyms RPC155, 9330175N20Rik, RPC1
MMRRC Submission 040344-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2363 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 24498764-24537126 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 24525960 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
AlphaFold B2RXC6
Predicted Effect probably null
Transcript: ENSMUST00000026322
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225526
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T C 2: 103,397,528 (GRCm39) C153R probably damaging Het
Adam23 A G 1: 63,596,650 (GRCm39) probably null Het
Adpgk G T 9: 59,222,136 (GRCm39) M354I probably benign Het
Atmin G T 8: 117,681,653 (GRCm39) probably null Het
C1rl G A 6: 124,486,069 (GRCm39) G480D probably benign Het
C4b G A 17: 34,955,032 (GRCm39) probably benign Het
Cacnb1 G A 11: 97,903,672 (GRCm39) T127I possibly damaging Het
Cmya5 A T 13: 93,230,210 (GRCm39) V1626E probably benign Het
Cndp2 C T 18: 84,686,694 (GRCm39) G443S probably damaging Het
Crb1 A G 1: 139,265,016 (GRCm39) I134T possibly damaging Het
Dnaaf3 T C 7: 4,535,276 (GRCm39) probably null Het
Enam C T 5: 88,651,008 (GRCm39) P764L probably benign Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Fbln1 G A 15: 85,111,341 (GRCm39) probably null Het
Flnb A G 14: 7,945,950 (GRCm38) I2452V possibly damaging Het
Fmo3 A T 1: 162,781,884 (GRCm39) W490R probably damaging Het
Gabrb1 C T 5: 72,026,916 (GRCm39) R106* probably null Het
Galnt4 C T 10: 98,944,923 (GRCm39) T216I probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Golph3 A G 15: 12,349,649 (GRCm39) D223G probably benign Het
Herc4 T A 10: 63,151,473 (GRCm39) F905I possibly damaging Het
Il23r T C 6: 67,429,401 (GRCm39) T314A probably benign Het
Lrrtm4 T C 6: 79,998,857 (GRCm39) W90R probably damaging Het
Maml2 C T 9: 13,532,541 (GRCm39) T585I probably damaging Het
Mpp3 G A 11: 101,911,312 (GRCm39) A170V probably damaging Het
Naip6 T A 13: 100,452,928 (GRCm39) K44N possibly damaging Het
Or10aa3 C T 1: 173,878,814 (GRCm39) R292C probably damaging Het
Or10ak7 C T 4: 118,791,230 (GRCm39) E272K probably benign Het
Or1e17 A G 11: 73,831,182 (GRCm39) T37A possibly damaging Het
Or4k51 C T 2: 111,585,139 (GRCm39) P182S probably damaging Het
Or51b6 T A 7: 103,556,267 (GRCm39) M207K probably benign Het
Or6f2 A G 7: 139,756,878 (GRCm39) T282A probably damaging Het
Or7e165 T G 9: 19,694,892 (GRCm39) I154M probably benign Het
Or8c10 T C 9: 38,279,394 (GRCm39) I174T probably damaging Het
Pak1 T A 7: 97,535,521 (GRCm39) V204E probably benign Het
Pcdhb10 T A 18: 37,547,190 (GRCm39) C755* probably null Het
Pcdhb20 A G 18: 37,638,725 (GRCm39) Y417C probably damaging Het
Pkd1l3 G T 8: 110,355,341 (GRCm39) W723L probably benign Het
Plin1 C T 7: 79,376,139 (GRCm39) probably null Het
Ranbp2 A T 10: 58,314,758 (GRCm39) K1826I possibly damaging Het
Rapgef1 A G 2: 29,626,608 (GRCm39) I970V possibly damaging Het
Rdx C A 9: 51,980,173 (GRCm39) F255L probably damaging Het
Rp1l1 A T 14: 64,267,447 (GRCm39) H1011L possibly damaging Het
Serpina6 T C 12: 103,614,868 (GRCm39) D326G probably benign Het
Sh3tc2 A G 18: 62,123,966 (GRCm39) E909G probably benign Het
Shprh T A 10: 11,047,697 (GRCm39) V1015D probably damaging Het
Slfn8 A T 11: 82,894,920 (GRCm39) Y629N probably damaging Het
Triml1 A G 8: 43,594,408 (GRCm39) S8P probably damaging Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24,525,931 (GRCm39) missense probably benign 0.35
IGL00974:Polr3a APN 14 24,529,492 (GRCm39) missense probably benign 0.05
IGL01348:Polr3a APN 14 24,511,831 (GRCm39) missense probably damaging 1.00
IGL01464:Polr3a APN 14 24,520,749 (GRCm39) splice site probably benign
IGL01785:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01786:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01936:Polr3a APN 14 24,529,256 (GRCm39) missense probably damaging 1.00
IGL02095:Polr3a APN 14 24,504,678 (GRCm39) missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24,525,891 (GRCm39) missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24,520,945 (GRCm39) missense probably benign 0.07
IGL02961:Polr3a APN 14 24,517,108 (GRCm39) nonsense probably null
IGL03069:Polr3a APN 14 24,511,808 (GRCm39) missense probably damaging 0.99
R0001:Polr3a UTSW 14 24,502,257 (GRCm39) splice site probably benign
R0048:Polr3a UTSW 14 24,519,323 (GRCm39) splice site probably benign
R0157:Polr3a UTSW 14 24,529,254 (GRCm39) missense probably damaging 0.99
R0445:Polr3a UTSW 14 24,504,989 (GRCm39) missense probably benign 0.00
R0449:Polr3a UTSW 14 24,534,534 (GRCm39) missense probably damaging 0.99
R0597:Polr3a UTSW 14 24,534,202 (GRCm39) missense probably benign 0.29
R0604:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0644:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0703:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0754:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0767:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0816:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0817:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0819:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0840:Polr3a UTSW 14 24,502,268 (GRCm39) missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24,502,616 (GRCm39) missense probably null 0.98
R1644:Polr3a UTSW 14 24,520,692 (GRCm39) missense probably damaging 1.00
R1699:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R1704:Polr3a UTSW 14 24,534,188 (GRCm39) nonsense probably null
R3419:Polr3a UTSW 14 24,517,103 (GRCm39) missense probably damaging 1.00
R3934:Polr3a UTSW 14 24,526,169 (GRCm39) missense probably benign 0.30
R4296:Polr3a UTSW 14 24,503,264 (GRCm39) missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24,502,576 (GRCm39) splice site probably null
R4690:Polr3a UTSW 14 24,514,349 (GRCm39) missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24,502,692 (GRCm39) missense probably benign 0.11
R4947:Polr3a UTSW 14 24,532,532 (GRCm39) missense probably benign 0.00
R5232:Polr3a UTSW 14 24,503,279 (GRCm39) missense probably benign 0.00
R5263:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24,515,455 (GRCm39) splice site probably null
R5841:Polr3a UTSW 14 24,500,766 (GRCm39) missense probably benign 0.00
R6408:Polr3a UTSW 14 24,536,939 (GRCm39) critical splice donor site probably null
R6704:Polr3a UTSW 14 24,511,910 (GRCm39) missense probably damaging 1.00
R7136:Polr3a UTSW 14 24,511,883 (GRCm39) missense probably damaging 1.00
R7307:Polr3a UTSW 14 24,510,055 (GRCm39) missense probably benign 0.03
R7368:Polr3a UTSW 14 24,517,144 (GRCm39) missense probably damaging 0.98
R7800:Polr3a UTSW 14 24,534,455 (GRCm39) missense probably null 0.83
R8753:Polr3a UTSW 14 24,513,702 (GRCm39) nonsense probably null
R8785:Polr3a UTSW 14 24,502,383 (GRCm39) missense probably benign 0.06
R8848:Polr3a UTSW 14 24,500,834 (GRCm39) missense probably damaging 1.00
R9025:Polr3a UTSW 14 24,519,479 (GRCm39) missense probably damaging 1.00
R9139:Polr3a UTSW 14 24,519,416 (GRCm39) missense probably damaging 1.00
R9264:Polr3a UTSW 14 24,520,899 (GRCm39) missense probably benign
R9309:Polr3a UTSW 14 24,510,067 (GRCm39) missense probably benign
R9363:Polr3a UTSW 14 24,500,831 (GRCm39) missense probably damaging 1.00
R9526:Polr3a UTSW 14 24,503,313 (GRCm39) missense probably benign 0.00
R9585:Polr3a UTSW 14 24,502,289 (GRCm39) missense probably damaging 1.00
Z1088:Polr3a UTSW 14 24,529,792 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GACCCTGTATGTTCCTGCTCAG -3'
(R):5'- GGAAACTGGTTCGAAATGGCC -3'

Sequencing Primer
(F):5'- TGCTCAGCAGGAAGAAAGAGGC -3'
(R):5'- TCGAAATGGCCCAGATGTTC -3'
Posted On 2014-10-30