Incidental Mutation 'R0288:Zfp36'
ID24725
Institutional Source Beutler Lab
Gene Symbol Zfp36
Ensembl Gene ENSMUSG00000044786
Gene Namezinc finger protein 36
SynonymsTis11, Ttp, Zfp-36, Tristetraprolin, Nup475
MMRRC Submission 038507-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R0288 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28376784-28380253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28378241 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 81 (S81P)
Ref Sequence ENSEMBL: ENSMUSP00000146830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051241] [ENSMUST00000209061]
Predicted Effect probably benign
Transcript: ENSMUST00000051241
AA Change: S93P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057815
Gene: ENSMUSG00000044786
AA Change: S93P

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
ZnF_C3H1 95 122 7.54e-10 SMART
ZnF_C3H1 133 160 7.31e-8 SMART
low complexity region 178 222 N/A INTRINSIC
low complexity region 279 289 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208885
Predicted Effect probably benign
Transcript: ENSMUST00000209061
AA Change: S81P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.7%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Homozygotes are normal at birth but soon develop myeloid hyperplasia, cachexia, patchy alopecia, dermatitis, arthritis, loss of adiposity, conjunctivitis, glomerular mesangial thickening and autoimmunity, with variable severity. All aspects of the syndrome are normalized by TNF antibody treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,039,940 E413G possibly damaging Het
Amigo2 G T 15: 97,245,679 N287K probably damaging Het
Ankle2 T A 5: 110,236,390 I260K probably damaging Het
Apob C T 12: 7,990,779 R635* probably null Het
Camkv A G 9: 107,946,356 Y153C probably damaging Het
Capn9 A G 8: 124,600,491 probably benign Het
Ces2c A G 8: 104,849,744 I130V probably benign Het
Cfap44 T A 16: 44,415,894 probably benign Het
Cfhr3 A G 1: 139,597,687 noncoding transcript Het
Chmp1a G T 8: 123,208,006 D70E probably damaging Het
Coil G A 11: 88,981,868 G352R probably damaging Het
Colq T C 14: 31,543,992 E188G possibly damaging Het
Cyfip2 A G 11: 46,253,972 F685S possibly damaging Het
Cyp4f39 A G 17: 32,492,436 N519S probably benign Het
Dennd1c A T 17: 57,076,870 probably null Het
Dnah9 A T 11: 66,025,134 probably null Het
Dnmbp T C 19: 43,902,459 T290A possibly damaging Het
Dsc2 T C 18: 20,033,120 D818G probably damaging Het
Gnptab G A 10: 88,433,105 V557I probably benign Het
Hdac4 A T 1: 91,971,006 H675Q probably damaging Het
Kcnk3 T C 5: 30,588,420 M35T probably benign Het
Kif1b A T 4: 149,199,338 I1290N probably damaging Het
Klhl14 G A 18: 21,565,563 R398W probably damaging Het
Marveld1 T C 19: 42,147,826 F60L probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Ndst3 A T 3: 123,672,194 V43D probably benign Het
Nhsl1 A G 10: 18,524,046 D306G probably damaging Het
Nlrp2 A G 7: 5,328,545 V284A probably benign Het
Pcdhb15 T C 18: 37,475,398 V561A probably damaging Het
Pdcl2 T C 5: 76,312,497 I177V possibly damaging Het
Pkd1l3 G A 8: 109,646,499 probably null Het
Pla2g6 A C 15: 79,286,906 probably benign Het
Plekhj1 A T 10: 80,796,610 I122N probably damaging Het
Pmel T C 10: 128,714,306 I70T probably benign Het
Psip1 T C 4: 83,464,959 D273G probably damaging Het
Rictor A G 15: 6,786,540 I1098V probably benign Het
Rif1 T C 2: 52,110,013 S1160P probably damaging Het
Rsbn1l T C 5: 20,920,040 I255V probably damaging Het
Slc15a5 A G 6: 138,017,916 probably benign Het
Slc29a1 G A 17: 45,589,804 R111W probably damaging Het
Slc36a1 G A 11: 55,219,087 A74T probably damaging Het
Slc5a7 A T 17: 54,293,018 Y122* probably null Het
Slc6a3 G T 13: 73,560,928 G324W probably damaging Het
Sltm T C 9: 70,579,351 S433P probably damaging Het
Spta1 T C 1: 174,243,179 S2190P probably damaging Het
Sry A T Y: 2,662,818 F281I unknown Het
Stk32a T A 18: 43,304,995 probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbl3 G A 17: 24,701,807 H612Y probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Top2a A G 11: 99,016,423 probably benign Het
Usp9y A T Y: 1,333,606 probably benign Het
Vldlr G A 19: 27,240,651 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r28 A G 7: 5,488,021 L409P probably damaging Het
Vps13c T C 9: 67,927,366 V1659A probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp280d A T 9: 72,331,339 K646* probably null Het
Zfp618 A T 4: 63,132,934 T651S possibly damaging Het
Other mutations in Zfp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Zfp36 APN 7 28378463 missense probably damaging 0.99
IGL02094:Zfp36 APN 7 28377763 missense probably benign
R0241:Zfp36 UTSW 7 28378334 missense probably damaging 0.96
R0241:Zfp36 UTSW 7 28378334 missense probably damaging 0.96
R1941:Zfp36 UTSW 7 28377646 missense probably damaging 0.98
R3625:Zfp36 UTSW 7 28378256 missense probably benign 0.00
R3744:Zfp36 UTSW 7 28377776 missense probably benign 0.21
R4385:Zfp36 UTSW 7 28377691 missense probably benign 0.11
R5387:Zfp36 UTSW 7 28377868 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AGCTGATGCTTTGTCGCAGCAC -3'
(R):5'- TCGATGAGCCATGACCTGTCATCC -3'

Sequencing Primer
(F):5'- CTTTGTCGCAGCACATGGG -3'
(R):5'- GACTTTGGAACATAAACTCGGACTC -3'
Posted On2013-04-16