Incidental Mutation 'R2363:Pcdhb20'
ID247252
Institutional Source Beutler Lab
Gene Symbol Pcdhb20
Ensembl Gene ENSMUSG00000046191
Gene Nameprotocadherin beta 20
SynonymsPcdhbT, Pcdhb14
MMRRC Submission 040344-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R2363 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37504264-37507822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37505672 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 417 (Y417C)
Ref Sequence ENSEMBL: ENSMUSP00000137038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052179] [ENSMUST00000059571] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000052179
AA Change: Y417C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137038
Gene: ENSMUSG00000046191
AA Change: Y417C

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 8.3e-36 PFAM
low complexity region 136 148 N/A INTRINSIC
CA 155 240 1.41e-19 SMART
CA 264 345 2.91e-21 SMART
CA 368 449 1.12e-22 SMART
CA 473 559 3.41e-27 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 769 7.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059571
SMART Domains Protein: ENSMUSP00000053326
Gene: ENSMUSG00000043313

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 45 131 4.8e-1 SMART
CA 155 240 6.58e-20 SMART
CA 264 345 1.03e-21 SMART
CA 368 449 4.21e-18 SMART
CA 473 559 3.36e-26 SMART
CA 589 670 6.69e-12 SMART
Pfam:Cadherin_C_2 686 769 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.8166 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T C 2: 103,567,183 C153R probably damaging Het
Adam23 A G 1: 63,557,491 probably null Het
Adpgk G T 9: 59,314,853 M354I probably benign Het
Atmin G T 8: 116,954,914 probably null Het
C1rl G A 6: 124,509,110 G480D probably benign Het
C4b G A 17: 34,736,058 probably benign Het
Cacnb1 G A 11: 98,012,846 T127I possibly damaging Het
Cmya5 A T 13: 93,093,702 V1626E probably benign Het
Cndp2 C T 18: 84,668,569 G443S probably damaging Het
Crb1 A G 1: 139,337,278 I134T possibly damaging Het
Dnaaf3 T C 7: 4,532,277 probably null Het
Enam C T 5: 88,503,149 P764L probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbln1 G A 15: 85,227,140 probably null Het
Flnb A G 14: 7,945,950 I2452V possibly damaging Het
Fmo3 A T 1: 162,954,315 W490R probably damaging Het
Gabrb1 C T 5: 71,869,573 R106* probably null Het
Galnt4 C T 10: 99,109,061 T216I probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Golph3 A G 15: 12,349,563 D223G probably benign Het
Herc4 T A 10: 63,315,694 F905I possibly damaging Het
Il23r T C 6: 67,452,417 T314A probably benign Het
Lrrtm4 T C 6: 80,021,874 W90R probably damaging Het
Maml2 C T 9: 13,621,245 T585I probably damaging Het
Mpp3 G A 11: 102,020,486 A170V probably damaging Het
Naip6 T A 13: 100,316,420 K44N possibly damaging Het
Olfr1301 C T 2: 111,754,794 P182S probably damaging Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr250 T C 9: 38,368,098 I174T probably damaging Het
Olfr432 C T 1: 174,051,248 R292C probably damaging Het
Olfr523 A G 7: 140,176,965 T282A probably damaging Het
Olfr58 T G 9: 19,783,596 I154M probably benign Het
Olfr65 T A 7: 103,907,060 M207K probably benign Het
Pak1 T A 7: 97,886,314 V204E probably benign Het
Pcdhb10 T A 18: 37,414,137 C755* probably null Het
Pkd1l3 G T 8: 109,628,709 W723L probably benign Het
Plin1 C T 7: 79,726,391 probably null Het
Polr3a A T 14: 24,475,892 probably null Het
Ranbp2 A T 10: 58,478,936 K1826I possibly damaging Het
Rapgef1 A G 2: 29,736,596 I970V possibly damaging Het
Rdx C A 9: 52,068,873 F255L probably damaging Het
Rp1l1 A T 14: 64,029,998 H1011L possibly damaging Het
Serpina6 T C 12: 103,648,609 D326G probably benign Het
Sh3tc2 A G 18: 61,990,895 E909G probably benign Het
Shprh T A 10: 11,171,953 V1015D probably damaging Het
Slfn8 A T 11: 83,004,094 Y629N probably damaging Het
Triml1 A G 8: 43,141,371 S8P probably damaging Het
Other mutations in Pcdhb20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Pcdhb20 APN 18 37504685 missense possibly damaging 0.87
IGL01373:Pcdhb20 APN 18 37506568 missense probably benign 0.10
IGL01556:Pcdhb20 APN 18 37504799 missense possibly damaging 0.88
IGL01621:Pcdhb20 APN 18 37504807 missense possibly damaging 0.49
IGL01768:Pcdhb20 APN 18 37506715 missense possibly damaging 0.80
IGL01859:Pcdhb20 APN 18 37504563 missense probably damaging 0.98
IGL02492:Pcdhb20 APN 18 37506400 missense probably benign 0.43
IGL03057:Pcdhb20 APN 18 37504798 missense possibly damaging 0.74
IGL02991:Pcdhb20 UTSW 18 37506211 missense probably damaging 1.00
R0799:Pcdhb20 UTSW 18 37505885 missense probably damaging 1.00
R1465:Pcdhb20 UTSW 18 37504697 missense probably damaging 0.99
R1465:Pcdhb20 UTSW 18 37504697 missense probably damaging 0.99
R2012:Pcdhb20 UTSW 18 37505074 missense probably damaging 0.99
R2079:Pcdhb20 UTSW 18 37505171 missense probably benign 0.07
R2350:Pcdhb20 UTSW 18 37504510 missense probably benign 0.01
R2364:Pcdhb20 UTSW 18 37505938 missense probably damaging 1.00
R2870:Pcdhb20 UTSW 18 37505780 missense possibly damaging 0.82
R2870:Pcdhb20 UTSW 18 37505780 missense possibly damaging 0.82
R4060:Pcdhb20 UTSW 18 37506164 missense probably damaging 1.00
R4609:Pcdhb20 UTSW 18 37505796 missense probably benign 0.02
R4750:Pcdhb20 UTSW 18 37506131 missense possibly damaging 0.48
R4897:Pcdhb20 UTSW 18 37506245 missense possibly damaging 0.70
R4970:Pcdhb20 UTSW 18 37506771 missense probably benign 0.00
R5098:Pcdhb20 UTSW 18 37504805 missense probably damaging 1.00
R5616:Pcdhb20 UTSW 18 37504532 missense probably damaging 0.97
R5890:Pcdhb20 UTSW 18 37505233 missense probably benign 0.00
R6225:Pcdhb20 UTSW 18 37504994 missense probably damaging 1.00
R6248:Pcdhb20 UTSW 18 37506232 missense probably damaging 0.99
R6419:Pcdhb20 UTSW 18 37505555 missense probably damaging 1.00
R6814:Pcdhb20 UTSW 18 37506165 missense probably benign 0.22
R6821:Pcdhb20 UTSW 18 37506122 missense probably damaging 1.00
R6824:Pcdhb20 UTSW 18 37505699 missense probably benign 0.06
R6872:Pcdhb20 UTSW 18 37506165 missense probably benign 0.22
R7040:Pcdhb20 UTSW 18 37504717 missense probably benign 0.00
R7145:Pcdhb20 UTSW 18 37505089 missense probably damaging 1.00
R7165:Pcdhb20 UTSW 18 37505070 missense probably damaging 1.00
R7215:Pcdhb20 UTSW 18 37505386 missense probably benign 0.24
R7265:Pcdhb20 UTSW 18 37505563 missense possibly damaging 0.95
R7372:Pcdhb20 UTSW 18 37506787 missense probably benign 0.00
R7402:Pcdhb20 UTSW 18 37504952 missense probably benign 0.05
R7718:Pcdhb20 UTSW 18 37505651 missense probably damaging 1.00
R7794:Pcdhb20 UTSW 18 37504432 missense probably benign 0.00
R7842:Pcdhb20 UTSW 18 37505059 missense possibly damaging 0.94
R7925:Pcdhb20 UTSW 18 37505059 missense possibly damaging 0.94
R8084:Pcdhb20 UTSW 18 37506173 missense possibly damaging 0.95
R8133:Pcdhb20 UTSW 18 37506610 nonsense probably null
Z1177:Pcdhb20 UTSW 18 37504588 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTCGTCGGTTACAAAGGC -3'
(R):5'- CATTGGAGCCTGAGTCTTTGTC -3'

Sequencing Primer
(F):5'- GTCGTCGGTTACAAAGGCAATTCC -3'
(R):5'- CCTGAGTCTTTGTCTGTGGCAC -3'
Posted On2014-10-30