Incidental Mutation 'R2363:Cndp2'
ID 247254
Institutional Source Beutler Lab
Gene Symbol Cndp2
Ensembl Gene ENSMUSG00000024644
Gene Name CNDP dipeptidase 2 (metallopeptidase M20 family)
Synonyms Pep1, Dip-2, 0610010E05Rik, Cn2, Pep-1
MMRRC Submission 040344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2363 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 84667470-84685633 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84668569 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 443 (G443S)
Ref Sequence ENSEMBL: ENSMUSP00000128696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025546] [ENSMUST00000168419]
AlphaFold Q9D1A2
Predicted Effect probably damaging
Transcript: ENSMUST00000025546
AA Change: G443S

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025546
Gene: ENSMUSG00000024644
AA Change: G443S

DomainStartEndE-ValueType
low complexity region 75 82 N/A INTRINSIC
Pfam:Peptidase_M20 95 469 6.8e-35 PFAM
Pfam:M20_dimer 208 369 2.1e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168419
AA Change: G443S

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128696
Gene: ENSMUSG00000024644
AA Change: G443S

DomainStartEndE-ValueType
low complexity region 75 82 N/A INTRINSIC
Pfam:Peptidase_M20 95 469 6.2e-33 PFAM
Pfam:M20_dimer 208 369 2.1e-15 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CNDP2, also known as tissue carnosinase and peptidase A (EC 3.4.13.18), is a nonspecific dipeptidase rather than a selective carnosinase (Teufel et al., 2003 [PubMed 12473676]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 T C 2: 103,567,183 C153R probably damaging Het
Adam23 A G 1: 63,557,491 probably null Het
Adpgk G T 9: 59,314,853 M354I probably benign Het
Atmin G T 8: 116,954,914 probably null Het
C1rl G A 6: 124,509,110 G480D probably benign Het
C4b G A 17: 34,736,058 probably benign Het
Cacnb1 G A 11: 98,012,846 T127I possibly damaging Het
Cmya5 A T 13: 93,093,702 V1626E probably benign Het
Crb1 A G 1: 139,337,278 I134T possibly damaging Het
Dnaaf3 T C 7: 4,532,277 probably null Het
Enam C T 5: 88,503,149 P764L probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbln1 G A 15: 85,227,140 probably null Het
Flnb A G 14: 7,945,950 I2452V possibly damaging Het
Fmo3 A T 1: 162,954,315 W490R probably damaging Het
Gabrb1 C T 5: 71,869,573 R106* probably null Het
Galnt4 C T 10: 99,109,061 T216I probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Golph3 A G 15: 12,349,563 D223G probably benign Het
Herc4 T A 10: 63,315,694 F905I possibly damaging Het
Il23r T C 6: 67,452,417 T314A probably benign Het
Lrrtm4 T C 6: 80,021,874 W90R probably damaging Het
Maml2 C T 9: 13,621,245 T585I probably damaging Het
Mpp3 G A 11: 102,020,486 A170V probably damaging Het
Naip6 T A 13: 100,316,420 K44N possibly damaging Het
Olfr1301 C T 2: 111,754,794 P182S probably damaging Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr250 T C 9: 38,368,098 I174T probably damaging Het
Olfr432 C T 1: 174,051,248 R292C probably damaging Het
Olfr523 A G 7: 140,176,965 T282A probably damaging Het
Olfr58 T G 9: 19,783,596 I154M probably benign Het
Olfr65 T A 7: 103,907,060 M207K probably benign Het
Pak1 T A 7: 97,886,314 V204E probably benign Het
Pcdhb10 T A 18: 37,414,137 C755* probably null Het
Pcdhb20 A G 18: 37,505,672 Y417C probably damaging Het
Pkd1l3 G T 8: 109,628,709 W723L probably benign Het
Plin1 C T 7: 79,726,391 probably null Het
Polr3a A T 14: 24,475,892 probably null Het
Ranbp2 A T 10: 58,478,936 K1826I possibly damaging Het
Rapgef1 A G 2: 29,736,596 I970V possibly damaging Het
Rdx C A 9: 52,068,873 F255L probably damaging Het
Rp1l1 A T 14: 64,029,998 H1011L possibly damaging Het
Serpina6 T C 12: 103,648,609 D326G probably benign Het
Sh3tc2 A G 18: 61,990,895 E909G probably benign Het
Shprh T A 10: 11,171,953 V1015D probably damaging Het
Slfn8 A T 11: 83,004,094 Y629N probably damaging Het
Triml1 A G 8: 43,141,371 S8P probably damaging Het
Other mutations in Cndp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Cndp2 APN 18 84677376 missense probably damaging 1.00
IGL01143:Cndp2 APN 18 84677317 critical splice donor site probably null
IGL01310:Cndp2 APN 18 84670877 missense possibly damaging 0.95
IGL01408:Cndp2 APN 18 84670911 missense probably benign
IGL01520:Cndp2 APN 18 84668607 missense probably benign 0.03
IGL02095:Cndp2 APN 18 84681032 missense possibly damaging 0.67
R1108:Cndp2 UTSW 18 84675060 missense probably damaging 1.00
R1264:Cndp2 UTSW 18 84678791 missense possibly damaging 0.88
R1466:Cndp2 UTSW 18 84677315 splice site probably benign
R1584:Cndp2 UTSW 18 84677315 splice site probably benign
R2383:Cndp2 UTSW 18 84675090 missense possibly damaging 0.82
R3153:Cndp2 UTSW 18 84668597 missense probably benign 0.02
R4590:Cndp2 UTSW 18 84669808 missense probably damaging 1.00
R4788:Cndp2 UTSW 18 84675164 missense probably damaging 1.00
R5033:Cndp2 UTSW 18 84670829 missense possibly damaging 0.94
R5154:Cndp2 UTSW 18 84668602 missense probably benign 0.00
R5178:Cndp2 UTSW 18 84675028 missense probably benign 0.00
R5326:Cndp2 UTSW 18 84672076 missense probably damaging 1.00
R5542:Cndp2 UTSW 18 84672076 missense probably damaging 1.00
R5556:Cndp2 UTSW 18 84672124 missense probably benign 0.38
R5722:Cndp2 UTSW 18 84668078 nonsense probably null
R6431:Cndp2 UTSW 18 84675078 nonsense probably null
R6682:Cndp2 UTSW 18 84677330 missense probably benign 0.00
R7036:Cndp2 UTSW 18 84669945 missense possibly damaging 0.94
R7728:Cndp2 UTSW 18 84672077 missense probably benign 0.00
R7806:Cndp2 UTSW 18 84670820 missense probably benign
R8018:Cndp2 UTSW 18 84668602 missense probably benign 0.00
R8929:Cndp2 UTSW 18 84675173 missense probably benign 0.20
R8949:Cndp2 UTSW 18 84675005 missense probably damaging 1.00
R9127:Cndp2 UTSW 18 84680996 missense probably benign 0.01
R9455:Cndp2 UTSW 18 84672121 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATCCTGGGAGCAAATGGCC -3'
(R):5'- GTCTGGACTCATTGTTGCTAAG -3'

Sequencing Primer
(F):5'- CCTGGGAGCAAATGGCCATTATTTC -3'
(R):5'- ACTCATTGTTGCTAAGTGGTGGC -3'
Posted On 2014-10-30