Incidental Mutation 'R2364:Hs6st1'
ID247255
Institutional Source Beutler Lab
Gene Symbol Hs6st1
Ensembl Gene ENSMUSG00000045216
Gene Nameheparan sulfate 6-O-sulfotransferase 1
Synonyms6OST1
MMRRC Submission 040345-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R2364 (G1)
Quality Score99
Status Not validated
Chromosome1
Chromosomal Location36068400-36106446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36068719 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 21 (V21A)
Ref Sequence ENSEMBL: ENSMUSP00000085499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088174]
Predicted Effect probably benign
Transcript: ENSMUST00000088174
AA Change: V21A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000085499
Gene: ENSMUSG00000045216
AA Change: V21A

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
low complexity region 50 62 N/A INTRINSIC
Pfam:Sulfotransfer_2 79 351 2e-79 PFAM
coiled coil region 352 386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biological activities. This enzyme is a type II integral membrane protein and is responsible for 6-O-sulfation of heparan sulfate. This enzyme does not share significant sequence similarity with other known sulfotransferases. A pseudogene located on chromosome 1 has been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show prenatal loss, stunted growth, dilated alveoli and lower postweaning survival. Homozygotes for another null allele show additional defects in placenta, eye, phalanx and tarsus morphology. Homozygotes for a gene trapallele show altered retinal axon guidance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in Hs6st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Hs6st1 APN 1 36103704 missense probably damaging 0.98
IGL01721:Hs6st1 APN 1 36068935 missense probably damaging 1.00
IGL02123:Hs6st1 APN 1 36103871 missense possibly damaging 0.84
IGL02498:Hs6st1 APN 1 36103740 missense probably damaging 1.00
IGL02662:Hs6st1 APN 1 36103812 nonsense probably null
IGL02730:Hs6st1 APN 1 36103628 missense probably damaging 1.00
R0359:Hs6st1 UTSW 1 36069185 critical splice donor site probably null
R0360:Hs6st1 UTSW 1 36069185 critical splice donor site probably null
R1268:Hs6st1 UTSW 1 36068926 missense probably damaging 1.00
R1355:Hs6st1 UTSW 1 36103576 missense probably damaging 1.00
R1521:Hs6st1 UTSW 1 36068886 missense probably damaging 0.99
R1942:Hs6st1 UTSW 1 36068722 missense probably benign
R4418:Hs6st1 UTSW 1 36104027 missense probably damaging 1.00
R4570:Hs6st1 UTSW 1 36103547 missense possibly damaging 0.84
R5319:Hs6st1 UTSW 1 36104178 missense probably benign 0.01
R5370:Hs6st1 UTSW 1 36069081 missense probably damaging 0.99
R5567:Hs6st1 UTSW 1 36103638 missense probably benign 0.06
R5570:Hs6st1 UTSW 1 36103638 missense probably benign 0.06
R5668:Hs6st1 UTSW 1 36103889 missense probably damaging 0.98
R6966:Hs6st1 UTSW 1 36104218 nonsense probably null
R8129:Hs6st1 UTSW 1 36069024 missense probably damaging 1.00
R8351:Hs6st1 UTSW 1 36069060 missense probably damaging 1.00
R8451:Hs6st1 UTSW 1 36069060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTTGACAGTGTGAGAGAC -3'
(R):5'- CTTCTGGATGTGCAGGAAGAC -3'

Sequencing Primer
(F):5'- GTGCAGAGCGTTCTCGG -3'
(R):5'- TGTGCAGGAAGACGATCAC -3'
Posted On2014-10-30