Incidental Mutation 'R2364:Olfr357'
ID247256
Institutional Source Beutler Lab
Gene Symbol Olfr357
Ensembl Gene ENSMUSG00000055838
Gene Nameolfactory receptor 357
SynonymsGA_x6K02T2NLDC-33688556-33689482, MOR138-3
MMRRC Submission 040345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R2364 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36993827-37001847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36997565 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 252 (Y252H)
Ref Sequence ENSEMBL: ENSMUSP00000149727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069578] [ENSMUST00000213218] [ENSMUST00000216437]
Predicted Effect probably damaging
Transcript: ENSMUST00000069578
AA Change: Y252H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066272
Gene: ENSMUSG00000055838
AA Change: Y252H

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.6e-53 PFAM
Pfam:7tm_1 41 290 1.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213218
AA Change: Y252H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216437
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in Olfr357
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Olfr357 APN 2 36996943 missense probably benign
IGL02043:Olfr357 APN 2 36997465 nonsense probably null
IGL02277:Olfr357 APN 2 36997184 splice site probably null
IGL03037:Olfr357 APN 2 36997548 missense probably benign 0.00
IGL03378:Olfr357 APN 2 36996903 missense probably damaging 1.00
R0212:Olfr357 UTSW 2 36997323 missense probably damaging 0.98
R0212:Olfr357 UTSW 2 36997632 missense possibly damaging 0.92
R1334:Olfr357 UTSW 2 36996860 missense probably benign 0.27
R1704:Olfr357 UTSW 2 36996884 missense probably benign 0.34
R2020:Olfr357 UTSW 2 36997652 missense possibly damaging 0.85
R4700:Olfr357 UTSW 2 36997503 missense probably benign 0.01
R5105:Olfr357 UTSW 2 36997457 splice site probably null
R5234:Olfr357 UTSW 2 36997095 missense probably benign
R5557:Olfr357 UTSW 2 36997346 missense probably damaging 1.00
R5966:Olfr357 UTSW 2 36996945 missense possibly damaging 0.96
R6480:Olfr357 UTSW 2 36996995 missense probably benign 0.00
R7046:Olfr357 UTSW 2 36997161 missense probably benign 0.39
R7350:Olfr357 UTSW 2 36996861 missense possibly damaging 0.84
R7583:Olfr357 UTSW 2 36997080 missense probably damaging 1.00
R8128:Olfr357 UTSW 2 36997661 missense probably benign 0.13
R8196:Olfr357 UTSW 2 36996861 missense possibly damaging 0.84
R8475:Olfr357 UTSW 2 36997054 missense probably damaging 0.99
Z1088:Olfr357 UTSW 2 36997705 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATCTCCTGTAGCAGCACCC -3'
(R):5'- GTGAAGGGCAAAATGATTTTCTTAG -3'

Sequencing Primer
(F):5'- CCAACTCAACACCTTGATGATTC -3'
(R):5'- ATGGAATGTTGTTTAATGTTTGAGC -3'
Posted On2014-10-30