Incidental Mutation 'R2364:Wwtr1'
ID247258
Institutional Source Beutler Lab
Gene Symbol Wwtr1
Ensembl Gene ENSMUSG00000027803
Gene NameWW domain containing transcription regulator 1
Synonyms2610021I22Rik, transcriptional coactivator with PDZ binding motif, 2310058J06Rik, TAZ
MMRRC Submission 040345-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.791) question?
Stock #R2364 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location57455649-57575910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57462603 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 364 (T364A)
Ref Sequence ENSEMBL: ENSMUSP00000113040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029380] [ENSMUST00000120977]
Predicted Effect probably benign
Transcript: ENSMUST00000029380
AA Change: T307A

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029380
Gene: ENSMUSG00000027803
AA Change: T307A

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
PDB:3KYS|D 14 93 3e-18 PDB
low complexity region 94 113 N/A INTRINSIC
WW 125 157 4.5e-11 SMART
low complexity region 227 257 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120977
AA Change: T364A

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113040
Gene: ENSMUSG00000027803
AA Change: T364A

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 60 70 N/A INTRINSIC
PDB:3KYS|D 71 150 5e-18 PDB
low complexity region 151 170 N/A INTRINSIC
WW 182 214 4.5e-11 SMART
low complexity region 284 314 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a binding protein of the 14-3-3 family of proteins that regulate cell cycle progression, differentiation and apoptosis. The encoded protein is a transcriptional co-activator that binds to the PPXY motif present on transcription factors. The gene product contains a WW domain and, in the C-terminus, a conserved PDZ-binding motif. This gene is distinct from the gene encoding tafazzin. Both genes share the gene symbol Taz. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null mutation display polycystic kidneys, elevated blood urea nitrogen, partial postnatal lethality, premature death, reduced litter sizes, and mildly reduced body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in Wwtr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Wwtr1 APN 3 57463521 missense possibly damaging 0.46
IGL00230:Wwtr1 APN 3 57463491 missense probably benign 0.11
IGL01684:Wwtr1 APN 3 57575789 missense probably damaging 1.00
IGL01859:Wwtr1 APN 3 57477517 missense possibly damaging 0.95
IGL01936:Wwtr1 APN 3 57574820 splice site probably benign
IGL03235:Wwtr1 APN 3 57477533 missense probably benign 0.24
R0352:Wwtr1 UTSW 3 57575127 missense probably damaging 1.00
R0586:Wwtr1 UTSW 3 57459066 missense probably damaging 1.00
R1797:Wwtr1 UTSW 3 57462575 missense probably damaging 1.00
R4453:Wwtr1 UTSW 3 57575259 critical splice acceptor site probably null
R5325:Wwtr1 UTSW 3 57575237 missense probably benign 0.09
R6601:Wwtr1 UTSW 3 57575738 missense possibly damaging 0.89
R7915:Wwtr1 UTSW 3 57575599 critical splice donor site probably null
R8221:Wwtr1 UTSW 3 57459020 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCACAAACTCTGAAAGGTC -3'
(R):5'- AAACCCCTGCCCTTGTATGG -3'

Sequencing Primer
(F):5'- AATAGCAGACTGAGTGGAATTTTAG -3'
(R):5'- GGCCAGTTTTAGTGCATAGAATTG -3'
Posted On2014-10-30