Incidental Mutation 'R2364:Gstm5'
ID247259
Institutional Source Beutler Lab
Gene Symbol Gstm5
Ensembl Gene ENSMUSG00000004032
Gene Nameglutathione S-transferase, mu 5
Synonyms
MMRRC Submission 040345-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2364 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107895821-107898686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107896371 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 40 (E40G)
Ref Sequence ENSEMBL: ENSMUSP00000127840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004134] [ENSMUST00000037375] [ENSMUST00000170058] [ENSMUST00000172247] [ENSMUST00000167523] [ENSMUST00000169365] [ENSMUST00000167387]
Predicted Effect probably benign
Transcript: ENSMUST00000004134
AA Change: E40G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004134
Gene: ENSMUSG00000004032
AA Change: E40G

DomainStartEndE-ValueType
Pfam:GST_N 6 85 4e-23 PFAM
Pfam:GST_C 107 195 1.5e-19 PFAM
Pfam:GST_C_3 113 193 2.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037375
SMART Domains Protein: ENSMUSP00000042004
Gene: ENSMUSG00000040600

DomainStartEndE-ValueType
Pfam:PTB 28 155 3.7e-40 PFAM
low complexity region 204 214 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
SH3 460 515 5.19e-15 SMART
PDB:2E8M|A 516 582 3e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154329
Predicted Effect unknown
Transcript: ENSMUST00000170058
AA Change: E40G
SMART Domains Protein: ENSMUSP00000125913
Gene: ENSMUSG00000004032
AA Change: E40G

DomainStartEndE-ValueType
Pfam:GST_N 6 55 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172247
AA Change: E40G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000129426
Gene: ENSMUSG00000004032
AA Change: E40G

DomainStartEndE-ValueType
Pfam:GST_N 6 85 2.1e-21 PFAM
Pfam:GST_C 107 193 2.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167523
AA Change: E40G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000127840
Gene: ENSMUSG00000004032
AA Change: E40G

DomainStartEndE-ValueType
Pfam:GST_N 6 67 6.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169365
SMART Domains Protein: ENSMUSP00000128306
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_C 41 129 2.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163675
Predicted Effect probably benign
Transcript: ENSMUST00000167387
SMART Domains Protein: ENSMUSP00000127020
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_C 41 129 2.1e-19 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Mutations of this class mu gene have been linked with a slight increase in a number of cancers, likely due to exposure with environmental toxins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in Gstm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Gstm5 APN 3 107897558 missense probably benign 0.11
IGL02219:Gstm5 APN 3 107898031 missense probably damaging 1.00
R0685:Gstm5 UTSW 3 107897319 missense probably damaging 1.00
R3836:Gstm5 UTSW 3 107896362 missense probably benign 0.00
R4600:Gstm5 UTSW 3 107897986 missense probably damaging 1.00
R5097:Gstm5 UTSW 3 107895942 start gained probably benign
R5369:Gstm5 UTSW 3 107898466 missense probably damaging 1.00
R5415:Gstm5 UTSW 3 107897495 missense probably damaging 1.00
R5689:Gstm5 UTSW 3 107896665 missense probably damaging 0.97
R5832:Gstm5 UTSW 3 107897537 missense probably benign 0.01
R5988:Gstm5 UTSW 3 107895954 start codon destroyed probably benign
R7329:Gstm5 UTSW 3 107896331 missense possibly damaging 0.69
R7546:Gstm5 UTSW 3 107897294 missense probably damaging 1.00
X0020:Gstm5 UTSW 3 107895966 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGCTGCCTAAGGACAATTTCC -3'
(R):5'- AGACCTGTTATCTCAAGTTCCCAATC -3'

Sequencing Primer
(F):5'- ACGCAGGAGCTTGGCAG -3'
(R):5'- TCCCCAAAAACTAACCCTTGAGTTTC -3'
Posted On2014-10-30