Incidental Mutation 'R2364:Gstm5'
ID 247259
Institutional Source Beutler Lab
Gene Symbol Gstm5
Ensembl Gene ENSMUSG00000004032
Gene Name glutathione S-transferase, mu 5
Synonyms
MMRRC Submission 040345-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2364 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 107803240-107806002 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107803687 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 40 (E40G)
Ref Sequence ENSEMBL: ENSMUSP00000127840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004134] [ENSMUST00000037375] [ENSMUST00000170058] [ENSMUST00000167523] [ENSMUST00000169365] [ENSMUST00000167387] [ENSMUST00000172247]
AlphaFold P48774
Predicted Effect probably benign
Transcript: ENSMUST00000004134
AA Change: E40G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004134
Gene: ENSMUSG00000004032
AA Change: E40G

DomainStartEndE-ValueType
Pfam:GST_N 6 85 4e-23 PFAM
Pfam:GST_C 107 195 1.5e-19 PFAM
Pfam:GST_C_3 113 193 2.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037375
SMART Domains Protein: ENSMUSP00000042004
Gene: ENSMUSG00000040600

DomainStartEndE-ValueType
Pfam:PTB 28 155 3.7e-40 PFAM
low complexity region 204 214 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
SH3 460 515 5.19e-15 SMART
PDB:2E8M|A 516 582 3e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137800
Predicted Effect unknown
Transcript: ENSMUST00000170058
AA Change: E40G
SMART Domains Protein: ENSMUSP00000125913
Gene: ENSMUSG00000004032
AA Change: E40G

DomainStartEndE-ValueType
Pfam:GST_N 6 55 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167523
AA Change: E40G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000127840
Gene: ENSMUSG00000004032
AA Change: E40G

DomainStartEndE-ValueType
Pfam:GST_N 6 67 6.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169365
SMART Domains Protein: ENSMUSP00000128306
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_C 41 129 2.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163675
Predicted Effect probably benign
Transcript: ENSMUST00000167387
SMART Domains Protein: ENSMUSP00000127020
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_C 41 129 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172247
AA Change: E40G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000129426
Gene: ENSMUSG00000004032
AA Change: E40G

DomainStartEndE-ValueType
Pfam:GST_N 6 85 2.1e-21 PFAM
Pfam:GST_C 107 193 2.2e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Mutations of this class mu gene have been linked with a slight increase in a number of cancers, likely due to exposure with environmental toxins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 137,871,584 (GRCm39) S268P probably benign Het
Adam6a A G 12: 113,508,250 (GRCm39) K208E probably benign Het
Anks6 A G 4: 47,027,248 (GRCm39) S725P possibly damaging Het
Asb3 A G 11: 31,051,192 (GRCm39) I549V probably benign Het
Blvrb A G 7: 27,147,558 (GRCm39) I6V possibly damaging Het
Cabs1 A T 5: 88,128,092 (GRCm39) T248S probably benign Het
Cdk5rap2 A G 4: 70,279,046 (GRCm39) probably null Het
Cep250 G A 2: 155,834,552 (GRCm39) R2159K probably damaging Het
Dnajc28 G A 16: 91,413,755 (GRCm39) T187M probably damaging Het
Fpr1 A T 17: 18,097,872 (GRCm39) L39* probably null Het
Hnrnpr A G 4: 136,054,640 (GRCm39) M97V possibly damaging Het
Hs6st1 T C 1: 36,107,800 (GRCm39) V21A probably benign Het
Hsp90aa1 A T 12: 110,659,187 (GRCm39) F537I probably damaging Het
Insr T C 8: 3,224,820 (GRCm39) D216G probably benign Het
Kif2a A T 13: 107,113,344 (GRCm39) N428K probably damaging Het
Mapk10 G T 5: 103,186,507 (GRCm39) N38K possibly damaging Het
Myh8 A G 11: 67,185,344 (GRCm39) E865G probably benign Het
Or10ak7 C T 4: 118,791,230 (GRCm39) E272K probably benign Het
Or1q1 T C 2: 36,887,577 (GRCm39) Y252H probably damaging Het
Or4k6 A T 14: 50,475,612 (GRCm39) H243Q probably damaging Het
Or5b104 A G 19: 13,072,118 (GRCm39) V298A probably damaging Het
Os9 T A 10: 126,955,007 (GRCm39) K180N possibly damaging Het
Pcdhb20 A T 18: 37,638,991 (GRCm39) I506F probably damaging Het
Pros1 T G 16: 62,734,211 (GRCm39) L339R probably damaging Het
Srp72 A G 5: 77,132,209 (GRCm39) I266V probably benign Het
Tmem245 A G 4: 56,899,391 (GRCm39) V632A probably damaging Het
Tpcn1 G T 5: 120,691,559 (GRCm39) C298* probably null Het
Ubfd1 T A 7: 121,668,167 (GRCm39) D232E probably benign Het
Vamp1 A T 6: 125,217,306 (GRCm39) I117L probably benign Het
Wwtr1 T C 3: 57,370,024 (GRCm39) T364A possibly damaging Het
Zbtb47 C T 9: 121,596,660 (GRCm39) P672L probably damaging Het
Zfp143 C A 7: 109,682,449 (GRCm39) T339K probably damaging Het
Zfp317 A G 9: 19,559,031 (GRCm39) D415G probably benign Het
Zfp628 A G 7: 4,923,686 (GRCm39) H636R probably damaging Het
Other mutations in Gstm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Gstm5 APN 3 107,804,874 (GRCm39) missense probably benign 0.11
IGL02219:Gstm5 APN 3 107,805,347 (GRCm39) missense probably damaging 1.00
R0685:Gstm5 UTSW 3 107,804,635 (GRCm39) missense probably damaging 1.00
R3836:Gstm5 UTSW 3 107,803,678 (GRCm39) missense probably benign 0.00
R4600:Gstm5 UTSW 3 107,805,302 (GRCm39) missense probably damaging 1.00
R5097:Gstm5 UTSW 3 107,803,258 (GRCm39) start gained probably benign
R5369:Gstm5 UTSW 3 107,805,782 (GRCm39) missense probably damaging 1.00
R5415:Gstm5 UTSW 3 107,804,811 (GRCm39) missense probably damaging 1.00
R5689:Gstm5 UTSW 3 107,803,981 (GRCm39) missense probably damaging 0.97
R5832:Gstm5 UTSW 3 107,804,853 (GRCm39) missense probably benign 0.01
R5988:Gstm5 UTSW 3 107,803,270 (GRCm39) start codon destroyed probably benign
R7329:Gstm5 UTSW 3 107,803,647 (GRCm39) missense possibly damaging 0.69
R7546:Gstm5 UTSW 3 107,804,610 (GRCm39) missense probably damaging 1.00
R9222:Gstm5 UTSW 3 107,804,634 (GRCm39) missense probably benign 0.09
X0020:Gstm5 UTSW 3 107,803,282 (GRCm39) missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGCTGCCTAAGGACAATTTCC -3'
(R):5'- AGACCTGTTATCTCAAGTTCCCAATC -3'

Sequencing Primer
(F):5'- ACGCAGGAGCTTGGCAG -3'
(R):5'- TCCCCAAAAACTAACCCTTGAGTTTC -3'
Posted On 2014-10-30