Incidental Mutation 'R2364:Tmem245'
ID247262
Institutional Source Beutler Lab
Gene Symbol Tmem245
Ensembl Gene ENSMUSG00000055296
Gene Nametransmembrane protein 245
Synonyms
MMRRC Submission 040345-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R2364 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location56866923-56947437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56899391 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 632 (V632A)
Ref Sequence ENSEMBL: ENSMUSP00000103234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068792] [ENSMUST00000107609] [ENSMUST00000132816]
Predicted Effect probably damaging
Transcript: ENSMUST00000068792
AA Change: V628A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067421
Gene: ENSMUSG00000055296
AA Change: V628A

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
transmembrane domain 144 166 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 212 231 N/A INTRINSIC
transmembrane domain 235 252 N/A INTRINSIC
low complexity region 309 330 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 457 479 N/A INTRINSIC
Pfam:UPF0118 589 838 1.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000103982
Predicted Effect probably damaging
Transcript: ENSMUST00000107609
AA Change: V632A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103234
Gene: ENSMUSG00000055296
AA Change: V632A

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
transmembrane domain 144 166 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 212 231 N/A INTRINSIC
transmembrane domain 235 252 N/A INTRINSIC
low complexity region 309 330 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 449 471 N/A INTRINSIC
Pfam:UPF0118 585 842 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125082
Predicted Effect probably benign
Transcript: ENSMUST00000132816
AA Change: V223A

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117449
Gene: ENSMUSG00000055296
AA Change: V223A

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:UPF0118 182 433 4.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199731
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in Tmem245
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02472:Tmem245 APN 4 56899119 missense probably damaging 1.00
IGL02668:Tmem245 APN 4 56925081 missense possibly damaging 0.86
IGL03093:Tmem245 APN 4 56886019 missense probably damaging 1.00
R0090:Tmem245 UTSW 4 56899410 missense probably benign
R0116:Tmem245 UTSW 4 56926213 missense probably benign 0.00
R0648:Tmem245 UTSW 4 56906270 missense probably benign 0.38
R0864:Tmem245 UTSW 4 56890837 missense probably damaging 1.00
R1102:Tmem245 UTSW 4 56903200 intron probably benign
R1548:Tmem245 UTSW 4 56906233 nonsense probably null
R1778:Tmem245 UTSW 4 56903968 missense probably damaging 1.00
R1840:Tmem245 UTSW 4 56903947 missense probably benign 0.03
R1942:Tmem245 UTSW 4 56923511 unclassified probably benign
R1969:Tmem245 UTSW 4 56937964 missense probably benign 0.01
R2341:Tmem245 UTSW 4 56937957 missense probably damaging 1.00
R3848:Tmem245 UTSW 4 56926298 unclassified probably benign
R4591:Tmem245 UTSW 4 56910204 missense probably damaging 0.99
R4772:Tmem245 UTSW 4 56937989 splice site probably null
R4779:Tmem245 UTSW 4 56936468 missense possibly damaging 0.65
R4860:Tmem245 UTSW 4 56899164 missense probably damaging 1.00
R4860:Tmem245 UTSW 4 56899164 missense probably damaging 1.00
R5049:Tmem245 UTSW 4 56925057 missense probably benign 0.12
R5061:Tmem245 UTSW 4 56946945 missense possibly damaging 0.94
R5199:Tmem245 UTSW 4 56925149 missense probably benign 0.12
R5377:Tmem245 UTSW 4 56947084 missense probably damaging 0.99
R5547:Tmem245 UTSW 4 56910156 critical splice donor site probably null
R5846:Tmem245 UTSW 4 56903241 missense probably benign 0.00
R5851:Tmem245 UTSW 4 56916770 missense probably benign 0.02
R5991:Tmem245 UTSW 4 56916733 missense probably damaging 1.00
R6314:Tmem245 UTSW 4 56888592 missense possibly damaging 0.88
R6992:Tmem245 UTSW 4 56937940 missense probably benign 0.03
R7172:Tmem245 UTSW 4 56903946 missense possibly damaging 0.65
R7632:Tmem245 UTSW 4 56916787 missense probably benign 0.00
R7660:Tmem245 UTSW 4 56899170 missense possibly damaging 0.79
R7672:Tmem245 UTSW 4 56947069 missense probably benign
R7735:Tmem245 UTSW 4 56925155 missense probably benign 0.22
R7900:Tmem245 UTSW 4 56924973 splice site probably null
R8280:Tmem245 UTSW 4 56890884 missense possibly damaging 0.89
R8306:Tmem245 UTSW 4 56886037 missense probably damaging 0.96
R8446:Tmem245 UTSW 4 56906261 missense probably benign 0.24
R8447:Tmem245 UTSW 4 56906261 missense probably benign 0.24
R8491:Tmem245 UTSW 4 56906261 missense probably benign 0.24
R8524:Tmem245 UTSW 4 56906261 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GAGCGTATAAAAGCTATACATGCG -3'
(R):5'- GAAATGTCTATGATAGTTGCGGTAC -3'

Sequencing Primer
(F):5'- GCTATACATGCGCAAAAACAGAG -3'
(R):5'- TGATAGTTGCGGTACTATTTTAAGTG -3'
Posted On2014-10-30