Incidental Mutation 'R2364:Mapk10'
ID247268
Institutional Source Beutler Lab
Gene Symbol Mapk10
Ensembl Gene ENSMUSG00000046709
Gene Namemitogen-activated protein kinase 10
Synonymsp493F12, JNK3, Serk2, C230008H04Rik
MMRRC Submission 040345-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2364 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location102907948-103211334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 103038641 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 38 (N38K)
Ref Sequence ENSEMBL: ENSMUSP00000142798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086854] [ENSMUST00000112846] [ENSMUST00000112847] [ENSMUST00000112848] [ENSMUST00000133069] [ENSMUST00000141573] [ENSMUST00000170792]
Predicted Effect probably benign
Transcript: ENSMUST00000086854
AA Change: N38K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000084065
Gene: ENSMUSG00000046709
AA Change: N38K

DomainStartEndE-ValueType
S_TKc 64 359 5.76e-88 SMART
low complexity region 423 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112846
AA Change: N38K

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108467
Gene: ENSMUSG00000046709
AA Change: N38K

DomainStartEndE-ValueType
S_TKc 64 359 4.37e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112847
AA Change: N38K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000108468
Gene: ENSMUSG00000046709
AA Change: N38K

DomainStartEndE-ValueType
S_TKc 64 359 4.37e-88 SMART
low complexity region 423 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112848
AA Change: N68K

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108469
Gene: ENSMUSG00000046709
AA Change: N68K

DomainStartEndE-ValueType
S_TKc 94 389 4.37e-88 SMART
low complexity region 453 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133069
AA Change: N38K

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143609
Gene: ENSMUSG00000046709
AA Change: N38K

DomainStartEndE-ValueType
S_TKc 64 252 1.4e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000141573
AA Change: N38K

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142798
Gene: ENSMUSG00000046709
AA Change: N38K

DomainStartEndE-ValueType
Pfam:Pkinase 64 125 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170792
AA Change: N38K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000127193
Gene: ENSMUSG00000046709
AA Change: N38K

DomainStartEndE-ValueType
S_TKc 64 359 4.37e-88 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as integration points for multiple biochemical signals and are involved in a wide variety of cellular processes, such as proliferation, differentiation, transcription regulation and development. This kinase is specifically expressed in a subset of neurons in the nervous system and is activated by threonine and tyrosine phosphorylation. Targeted deletion of this gene in mice suggests that it may have a role in stress-induced neuronal apoptosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. They are resistant to kainic acid induced seizures and show increased resistance to MPTP induced Parkinson's disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in Mapk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Mapk10 APN 5 102926152 splice site probably benign
IGL01791:Mapk10 APN 5 102996648 missense probably damaging 1.00
IGL01885:Mapk10 APN 5 102996589 missense probably damaging 1.00
IGL02192:Mapk10 APN 5 102989647 missense probably damaging 0.97
IGL02260:Mapk10 APN 5 103038668 missense probably benign 0.09
IGL02409:Mapk10 APN 5 102928230 missense possibly damaging 0.50
IGL03148:Mapk10 APN 5 102926105 missense probably damaging 1.00
R0904:Mapk10 UTSW 5 102987280 splice site probably benign
R1067:Mapk10 UTSW 5 102991857 splice site probably benign
R1592:Mapk10 UTSW 5 103038621 missense possibly damaging 0.89
R1812:Mapk10 UTSW 5 102913262 missense probably damaging 1.00
R2866:Mapk10 UTSW 5 103038682 missense probably benign 0.25
R2867:Mapk10 UTSW 5 103038682 missense probably benign 0.25
R2867:Mapk10 UTSW 5 103038682 missense probably benign 0.25
R4622:Mapk10 UTSW 5 102989724 missense probably damaging 1.00
R4860:Mapk10 UTSW 5 102990619 missense probably damaging 1.00
R4860:Mapk10 UTSW 5 102990619 missense probably damaging 1.00
R4866:Mapk10 UTSW 5 102963525 missense probably damaging 1.00
R5901:Mapk10 UTSW 5 102913292 missense probably damaging 1.00
R5986:Mapk10 UTSW 5 103038580 missense probably benign 0.33
R6000:Mapk10 UTSW 5 102966475 missense probably damaging 1.00
R6000:Mapk10 UTSW 5 102966476 missense probably damaging 1.00
R7375:Mapk10 UTSW 5 102976390 missense probably null 0.26
R7460:Mapk10 UTSW 5 103038577 missense probably benign 0.37
R7753:Mapk10 UTSW 5 103038553 nonsense probably null
R7879:Mapk10 UTSW 5 102963496 missense probably benign 0.10
R7935:Mapk10 UTSW 5 102991926 missense possibly damaging 0.92
R8059:Mapk10 UTSW 5 102966612 missense probably damaging 1.00
Z1176:Mapk10 UTSW 5 102991887 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTTGTAAATGAATCTAGCATACTCCC -3'
(R):5'- CTCATAGGGTCTGTATTTCCAGGC -3'

Sequencing Primer
(F):5'- ACTCCCTTTAAAAGTAGATCAAATCC -3'
(R):5'- GTCTGTATTTCCAGGCCTTAAACATG -3'
Posted On2014-10-30