Incidental Mutation 'R2364:Vamp1'
ID247270
Institutional Source Beutler Lab
Gene Symbol Vamp1
Ensembl Gene ENSMUSG00000030337
Gene Namevesicle-associated membrane protein 1
Synonymslew, Syb1, Syb-1, VAMP-1
MMRRC Submission 040345-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2364 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125215551-125245964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125240343 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 117 (I117L)
Ref Sequence ENSEMBL: ENSMUSP00000063466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032486] [ENSMUST00000063588] [ENSMUST00000112281] [ENSMUST00000112282]
Predicted Effect probably benign
Transcript: ENSMUST00000032486
SMART Domains Protein: ENSMUSP00000032486
Gene: ENSMUSG00000030336

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TNFR 27 62 1.11e-2 SMART
TNFR 65 104 1.23e-4 SMART
low complexity region 131 147 N/A INTRINSIC
transmembrane domain 183 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063588
AA Change: I117L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000063466
Gene: ENSMUSG00000030337
AA Change: I117L

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:Synaptobrevin 30 118 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112281
SMART Domains Protein: ENSMUSP00000107900
Gene: ENSMUSG00000030336

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TNFR 27 62 1.11e-2 SMART
Blast:TNFR 65 100 4e-10 BLAST
transmembrane domain 120 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112282
SMART Domains Protein: ENSMUSP00000107901
Gene: ENSMUSG00000030336

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:TNFR 27 45 1e-6 BLAST
transmembrane domain 76 98 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160523
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Synapotobrevins, syntaxins, and the synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Mutations in this gene are associated with autosomal dominant spastic ataxia 1. Multiple alternative splice variants have been described, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a spontaneous mutation show a 30% reduction in body size, do not attempt to right themselves, become visibly immobile and lay on their side by postnatal day 10, and display a general lack of purposeful movement and wasting leading to death prior to weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in Vamp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02972:Vamp1 APN 6 125219647 missense probably benign 0.09
R6913:Vamp1 UTSW 6 125218945 missense probably damaging 1.00
R7465:Vamp1 UTSW 6 125218575 missense unknown
Predicted Primers PCR Primer
(F):5'- CCGTGAGATCCCAATTCTCC -3'
(R):5'- GCAAATCAGCAATGAGTCCTC -3'

Sequencing Primer
(F):5'- CGAGAATTGTACCTCTTCTCTGAAG -3'
(R):5'- TTAATCCCAAGCATTCAGGTGGC -3'
Posted On2014-10-30